We narrowed to 93 results for: SAB;
-
TypeBlog Post...they identified mWasabi, a bright, monomeric green fluorescent protein. In vitro, mWasabi is 1.6-fold brighter...mNeonGreen. This fluorescent protein joins mTFP1 and mWasabi, as fluorophores from Allele Biotechnology that...relevant changes in pH. Find mTFP1 plasmids here! mWasabi: a bright green fluorescent protein The team that... that excite in the violet range. For example, mWasabi can be used with Sapphire (excitation maximum 399...significantly excite at 400 nm while EGFP does. Find mWasabi plasmids here! One of the most notable things about...localized to their expected locations. An analysis of mWasabi gave similar results. We hope this blog post helped...have plasmids containing mNeonGreen, mTFP1, or mWasabi that you would like to share with the scientific...
-
Plasmids 101: Using Transposons in the Lab
TypeBlog Post...sequences or target sites. Integration of most transposable elements (TEs) results in the duplication of...the site of insertion. Types of transposons Transposable elements are split into two classes based on...for much of the rest of this article. Class I Transposable elements (TEs): Retrotransposons Class I TEs...Sleeping beauty Sleeping Beauty is a synthetic transposable element developed from inactivated Tc1/mariner...Sternberg lab developed the INTEGRATE (Insertion of Transposable Elements by Guide RNA-Assisted Targeting) system... -
Lentiviral CRISPR Libraries Enable Genome-Scale, Knockout Screening
TypeBlog Post...MIT's Tim Wang and colleagues, including David Sabatini and Eric Lander, comprise 73,171 guide RNAs (gRNAs...genes and it includes more guides per gene. The Sabatini/Lander library uses sequential infection first...systematic genetic screens in mammalian cells,” David Sabatini, a senior author of one of the Science papers,... Using the CRISPR/Cas9 System. Wang T, Wei JJ, Sabatini DM, Lander ES. Science. 2013 Dec 12. (PubMed).... -
Modulate the Activity of 17 Signaling Pathways with One Kit!
TypeBlog Post...differentiation.” https://www.addgene.org/kits/sabatini-wood-cancer-pathway-orfs/ Finding signaling pathways... with “cloning guru” Kathleen Ottina and David Sabatini at the Whitehead Institute and MIT, started with...attached a DNA barcode to each to make the library usable for pooled screens. Applications of the cancer ... -
Viral Vectors 101: Systemic Capsids
TypeBlog Post...dependence. MDV1A and MDV1B were generated by the Sabeti lab using the DELIVER (Tabebordbar et al., 2021...systemic capsids were developed and deposited by the Sabeti lab for use in cynomolgus macaques. PAL1A, PAL1B... M., Ye, S., Solomon, I. H., Tabebordbar, M., & Sabeti, P. C. (2023). Systemic administration of novel...A., Horwitz, N., Beggs, A. H., Wagers, A. J., & Sabeti, P. C. (2021). Directed evolution of a family of.... P., Smith, J., Ibrahim, L. A., Mastro, K. J., Sabri, E., Huang, S., Favuzzi, E., … Dimidschstein, J.... -
Validated gRNA Sequences
TypeCollection...24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H...26472758 Sabatini C16orf80 H. sapiens TGTCTGAGAAGTAAACCCGT 70651 cut S. pyogenes 26472758 Sabatini C3orf17...26472758 Sabatini C3orf17 H. sapiens GTGTGAGAATCCCTAAGGCG 70652 cut S. pyogenes 26472758 Sabatini C9orf114...26472758 Sabatini C9orf114 H. sapiens GCGGCAGAGAAGGAGGACCG 70655 cut S. pyogenes 26472758 Sabatini CAN1 S...26472758 Sabatini DDX3Y H. sapiens TCTTGTTGGGGCTAAAACCA 70657 cut S. pyogenes 26472758 Sabatini DNMT3A ...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019...GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes 26472758 Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut... -
Handling Plasmids from Addgene - Purifying Plasmid DNA
TypeProtocol...purity of plasmid DNA purified without a kit it is advisable to perform a phenol/chloroform extraction of the...contaminants from the plasmid DNA. It is also advisable to add RNAse to the supernatant after step 6 to... -
CRISPR Pooled gRNA Libraries
TypeCollection...M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus (KSHV...genome-wide library Discontinued Knockout Human Sabatini and Lander 3rd 10 178,896 Activity-optimized genome-wide... genome-wide library 1000000100 Knockout Human Sabatini and Lander 3rd 10 187,535 Advanced Catalogue of...ribosomal, cell cycle) 51043 — 51048 Knockout Human Sabatini and Lander 3rd 10 Varies FNLCR CRISPRa Cell Surface...Human CRISPR Knockout Library 92352 Knockout Human Sabatini and Lander 3rd 50 6,661 Garnett Lab MinLibCas9...Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library 178284 Knockout Green Monkey Doench...Metabolic Gene Knockout Library 110066 Knockout Human Sabatini 3rd 10 30,290 Human DNA Binding Domain-Focused... -
Celebrating the 2024 Nobel Prize in Chemistry
TypeBlog Post...Nobel Prize in Chemistry last week alongside Demis Hassabis and John Jumper! The Baker Lab focuses on designing...approach. Congratulations to David Baker, Demis Hassabis, and John Jumper! References Kuhlman, B., Dantas... -
Bringing Sustainable Practices to the Lab: Easy Action Items
TypeBlog Post...everyone used a mug or reusable water bottle, you’d probably bring in a mug or reusable water bottle instead... -
Our Most Popular Blog Posts from 2019
TypeBlog Post...mNeonGreen, mTFP1, and mWasabi by Jennifer Tsang Learn about mNeonGreen, mTFP1, and mWasabi and find plasmids... -
mTOR Pathway
TypeCollection...this page was generated with the help of David Sabatini . mTOR Pathway Color is used for clarity and does...this page was generated with the help of David Sabatini . Return to top mTOR Pathway - Gene List Click...Return to top Resources Cancer Pathway ORF Kit (Sabatini & Wood) Tackling Cancers’ Drug Resistance with...with a New Screening Kit (from David Sabatini & Kris Wood) References mTOR signaling in growth control and... and disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017... -
The Stingy Scientist: How the Baby Gel Box Was Born
TypeBlog Post... instance, we have a plastic container problem…reusable containers pile up by the sink after lunch as ...thinking about conserving resources in the labs. Disposable plastic materials are fairly inexpensive in this... -
Summer SciComm Series: A PhD in Science Communication
TypeBlog Post... make reusable cloth menstrual pads while we talked about the environmental impact of disposable products... -
Overcoming the Challenges of Lentiviral Production
TypeBlog Post...for the experiment, trying to produce virus of a usable titer, or fine-tuning selection and expression ...filtered, and titered. A major obstacle in obtaining usable lentivirus is producing a high enough concentration... -
Viral Vectors 101: Virus Safety
TypeBlog Post...lentivirus, many organizations require or recommend disposable gowns over your lab coats and double gloving,... of without risking exposure. You can request disposable gowns from your lab or health and safety department... -
Plasmids 101: FLEx Vectors
TypeBlog Post... PMCID: PMC2593125. 4. Saunders A, Johnson CA, Sabatini BL. 2012. Novel recombinant adeno-associated viruses...these Addgene depositors: Ed Boyden Bernardo Sabatini Wenbiao Chen Liquin Luo Massimo Scanziani Scott... -
Illuminating Epigenetics with A FRET Based Biosensor
TypeBlog Post...characterized by intellectual and developmental disability, jerky movements, and spontaneous laughter or...by low muscle tone, short stature, cognitive disabilities, problem behaviors, and a chronic feeling of... -
10 Basic tips for mammalian cell culture
TypeBlog Post...bottles directly, rather decant the solutions into disposable sterile tubes first. Not only does this make ...and morphology, rendering their continued use inadvisable for experiments requiring reproducible results... -
INTEGRATE: Bacterial Genome Engineering Using CRISPR-Transposons
TypeBlog Post...capability was named INTEGRATE (Insertion of Transposable Elements by Guide RNA-Assisted Targeting) by...sequences using RNA-DNA base pairing. Separately, TnsABC forms a transposase complex with the mini-transposon...