We narrowed to 15 results for: SAB;
-
TypeCollection...24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758 Sabatini AAVS1 H...26472758 Sabatini C16orf80 H. sapiens TGTCTGAGAAGTAAACCCGT 70651 cut S. pyogenes 26472758 Sabatini C3orf17...26472758 Sabatini C3orf17 H. sapiens GTGTGAGAATCCCTAAGGCG 70652 cut S. pyogenes 26472758 Sabatini C9orf114...26472758 Sabatini C9orf114 H. sapiens GCGGCAGAGAAGGAGGACCG 70655 cut S. pyogenes 26472758 Sabatini CAN1 S...26472758 Sabatini DDX3Y H. sapiens TCTTGTTGGGGCTAAAACCA 70657 cut S. pyogenes 26472758 Sabatini DNMT3A ...GAGGCATATTCTTCTCCTGG 70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019...GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes 26472758 Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut...
-
CRISPR Pooled gRNA Libraries
TypeCollection...M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus (KSHV...genome-wide library Discontinued Knockout Human Sabatini and Lander 3rd 10 178,896 Activity-optimized genome-wide... genome-wide library 1000000100 Knockout Human Sabatini and Lander 3rd 10 187,535 Advanced Catalogue of...ribosomal, cell cycle) 51043 — 51048 Knockout Human Sabatini and Lander 3rd 10 Varies FNLCR CRISPRa Cell Surface...Human CRISPR Knockout Library 92352 Knockout Human Sabatini and Lander 3rd 50 6,661 Garnett Lab MinLibCas9...Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library 178284 Knockout Green Monkey Doench...Metabolic Gene Knockout Library 110066 Knockout Human Sabatini 3rd 10 30,290 Human DNA Binding Domain-Focused... -
mTOR Pathway
TypeCollection...this page was generated with the help of David Sabatini . mTOR Pathway Color is used for clarity and does...this page was generated with the help of David Sabatini . Return to top mTOR Pathway - Gene List Click...Return to top Resources Cancer Pathway ORF Kit (Sabatini & Wood) Tackling Cancers’ Drug Resistance with...with a New Screening Kit (from David Sabatini & Kris Wood) References mTOR signaling in growth control and... and disease. Laplante M, Sabatini DM. Cell. 2012 Apr 13;149(2):274-93. doi: 10.1016/j.cell.2012.03.017... -
Cancer Research Plasmids and Resources
TypeCollection...Cancer Pathways ORFs Kit : Set of vectors from the Sabatini & Wood Labs containing cDNAs for studying oncogenic...Drug Resistance with a New Screening Kit (David Sabatini & Kris Wood) National Cancer Institute (NCI) NCI... -
Lentivirus Plasmids
TypeCollection...can be used for cDNA expression; puro resistance Sabatini 14883 FUGW 3rd hUbC-driven EGFP; can be used for...EGFP 3rd for EGFP fusion; PGK driven puromycin Sabatini 25895 pLX301 3rd Gateway plasmid for CMV driven... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection... Brightness pKa Maturation Structure Plasmids mKusabira-Orange (mKO) 548 559 31 5 4.5 hr Monomer pQC mKorange... mKorange IX - Mammalian Expression mKusabira Orange-C1 (mKO) - Mammalian Expression mKO-pBAD - Bacterial... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Mammalian/Lentiviral See paper none S. pyogenes Blast Sabatini and Lander lentiCRISPR v2 52961 Mammalian/Lentiviral...Mammalian/Lentiviral hU6 none S. pyogenes Puro Sabatini sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR) 71485 Mammalian... -
CRISPR Guide
TypeCollection...them referred to as INTEGRATE ( I nsertion of T ransposable E lements by G uide R NA- A ssisted T argeting... 661–667. PMID: 25961408 Wang, T., Wei, J. J., Sabatini, D. M., & Lander, E. S. (2014). Genetic screens...Livny, J., Regev, A., Koonin, E. V., Hung, D. T., Sabeti, P. C., Collins, J. J., & Zhang, F. (2017). Nucleic... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...Strain CSH100 Content blocked, you may need to disable your ad-blocker.... -
CRISPR References and Information
TypeCollection...Cas9 ; p201N Cas9 ; pUC gRNA Shuttle PDF, 500 KB Sabatini and Lander gRNA cloning into pLX-sgRNA pLX-sgRNA... -
Deisseroth INTRSECT Collection
TypeCollection...Venkataraju K, Straub C, Wang W, Robertson K, Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal ... -
CRISPR History and Development for Genome Engineering
TypeCollection...351(6268):84-8. PMID: 26628643 Wang T, Wei JJ, Sabatini DM, Lander ES. 2014. Genetic Screens in Human ... -
Bacterial Expression Systems
TypeCollection...) Escherichia coli , Mycobacterium tuberculosis Sabine Ehrt 44561 pST-KT Pmyc1/TetO Anhydrotetracycline... -
Tetracycline Inducible Expression
TypeCollection...gene of interest. tTA-Advanced Tight TRE David Sabatini 19407 pTREtight2 Empty backbone for Tet-controlled... -
Neurodegeneration Plasmid Collection
TypeCollection...MJFF 38243 pLJM60-Tia1 TIA1 Flag CMV ALS David Sabatini 38248 pMXs-IP HA-Parkin PRKN HA Parkinson's Noboru...72873 PMXS-SLC1A3 SLC1A3 Episodic ataxia David Sabatini 74156 pCDNA3 HA C9ORF72 op C9orf72 HA CMV ALS ...