We narrowed to 6,439 results for: guide rna expression plasmid
-
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP
Plasmid#50946PurposeAn empty gRNA expression vectorDepositorInsertNone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pXR003: CasRx gRNA cloning backbone
Plasmid#109053PurposehU6-driven expression of guide RNAs compatible with CasRx. 5' processed DR followed by BbsI sites for guide cloning.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR2 DD (E488Q)_NES
Plasmid#124707PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with the MCP_ADAR2 DD(E488Q)_NESDepositorInsertMCP_ADAR2 DD (E488Q)_NES
UseAAVTagsNESExpressionMammalianMutationE488Q hyperactive mutantPromoterCMVAvailable SinceSept. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR1 DD (E1008Q)_NES
Plasmid#124703PurposeExpresses MS2_adRNA targeting the RAB7A locus along with MCP_ADAR1 DD (E1008Q)_NESDepositorInsertMCP_ADAR2 DD (E1008Q)_NES
UseAAVTagsNESExpressionMammalianMutationE1008Q hyperactive mutantPromoterCMVAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
GluR2_adRNA(1,20,6)-ADAR2(E488Q)
Plasmid#124621PurposeExpresses adRNA(1,20,6) targeting the RAB7A transcript along with the ADAR2(E488Q)DepositorInsertADAR2(E488Q)
UseAAVExpressionMammalianMutationE488Q hyperactive mutantPromoterCMVAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR2 DD (E488Q)_NLS
Plasmid#124705PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with the MCP_ADAR2 DD(E488Q)_NLSDepositorInsertMCP_ADAR2 DD (E488Q)_NLS
UseAAVTagsNLSExpressionMammalianMutationE488Q hyperactive mutantPromoterCMVAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR1 DD (E1008Q)_NLS
Plasmid#124626PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with the MCP_ADAR1 DD(E1008Q)_NLSDepositorInsertMCP_ADAR1 DD (E1008Q)_NLS
UseAAVTagsNLSExpressionMammalianMutationE1008Q hyperactive mutantPromoterCMVAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR2 DD_NES
Plasmid#124706PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with the MCP_ADAR2 DD_NESDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR1 DD_NES
Plasmid#124630PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with MCP_ADAR1 DD_NESDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro
Pooled Library#73178PurposeHuman sgRNA library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
Mouse sgRNA library Brie in lentiGuide-Puro
Pooled Library#73633PurposeMouse sgRNA library in backbone lentiGuide-Puro containing 78,637 unique sgRNAs targeting 19,674 genes along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR2 DD_NES
Plasmid#124706PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with the MCP_ADAR2 DD_NESDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MS2_adRNA-MCP_ADAR1 DD_NES
Plasmid#124630PurposeExpresses MS2_adRNA targeting the RAB7A transcript along with MCP_ADAR1 DD_NESDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
px552-U6-gRNA1-U6-gRNA2-CMV-eGFP
Plasmid#211760PurposePaired gRNAs (sgRNA1 and 2) targeting Exon 1 of VEGFA gene conserved across mouse, rhesus macaque, and human.DepositorInsertgRNA1 and gRNA2 targeting VEGF-A (VEGFA Mouse, M. mulatta (rhesus macaque), Human)
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-lib 2.0
Plasmid#89638PurposesgRNA expression in mammalian cells after Gateway cloningDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceFeb. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Wei lab paired-guide RNA (pgRNA) CRISPR–Cas9 library for human long non-coding RNAs (lncRNAs)
Pooled Library#89640PurposeDesigned for genomic deletion screening of functional lncRNAs (long non-coding RNAs) using lentiviral pgRNAs (paired-guide RNAs).DepositorExpressionMammalianUseLentiviralAvailable SinceMay 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
OgeuIscB CTG RNA
Plasmid#222865PurposeThis plasmid codes for the guide of the OgeuIscB with a CTG targetDepositorInsertOgeuIscB omega RNA with a (CTG)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 17, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
OgeuIscB GCT RNA
Plasmid#222862PurposeThis plasmid codes for the guide of the OgeuIscB with a GCT targetDepositorInsertOgeuIscB omega RNA with a (GCT)6 target sequence
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceOct. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits