We narrowed to 9,206 results for: sgRNA
-
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-SpCas9-sgRNA
Plasmid#179582PurposeExpresses spCas9 and gRNA that targets ColE1 plasmids for curingDepositorInsertCas9
ExpressionBacterialAvailable sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pyEvolvR (enCas9-PolI5M)
Plasmid#158073PurposeExpresses enCas9 fused to PolI5M in S. cerevisiae; contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
ExpressionBacterial and YeastAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_C1D (pP18(T)_B9-AVA4070)
Plasmid#239296PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting C1DDepositorInsertU6-driven sgRNA targeting C1D (C1D Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO2
Plasmid#217448PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2 PQBP1 KO1
Plasmid#217447PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human PQBP1DepositorAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJW1884
Plasmid#154332PurposesgRNA Target Vector for CRISPRDepositorInsertcxTi10882 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable sinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-UBF
Plasmid#247350PurposeExpresses SpCas9 and a sgRNA targeting the human UBF loci for knock-in.DepositorAvailable sinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF821-recipient_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211651PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF820-recipient_U6-sgRNA-EF1a-mCherry2
Plasmid#211647PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertGuide RNA recipient vector
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
eIF3k sgRNA-2 PX459 plasmid
Plasmid#192256Purposeexpressing sgRNA-2 targeting eIF3k locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3k locus closed to stop coden (EIF3K Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3k sgRNA-1 PX459 plasmid
Plasmid#192255Purposeexpressing sgRNA-1 targeting eIF3k locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3k locus closed to stop coden (EIF3K Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3f sgRNA-1 PX459 plasmid
Plasmid#192253Purposeexpressing sgRNA-1 targeting eIF3f locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3f locus closed to stop coden (EIF3F Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3f sgRNA-2 PX459 plasmid
Plasmid#192254Purposeexpressing sgRNA-2 targeting eIF3f locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3f locus closed to stop coden (EIF3F Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3b sgRNA-2 PX459 plasmid
Plasmid#192250Purposeexpressing sgRNA-2 targeting eIF3b locus closed to stop codenDepositorInsertsgRNA-2 targeting eIF3b locus closed to stop coden (EIF3B Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3b sgRNA-1 PX459 plasmid
Plasmid#192249Purposeexpressing sgRNA-1 targeting eIF3b locus closed to stop codenDepositorInsertsgRNA-1 targeting eIF3b locus closed to stop coden (EIF3B Human)
UseCRISPRExpressionMammalianAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-2 lentiCRISPR v2 plasmid
Plasmid#192232Purposelentiviral vector expressing sgRNA-2 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-2 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only