We narrowed to 46,662 results for: cha
-
Plasmid#232902PurposePlasmid carrying the rad53-5004 allele with its native promoter and terminator.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-nCLC
Plasmid#193564PurposeExpresses human Clathrin Light Chain B (neuronal isoform) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationNeuronal isoformPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
nCLC-ShadowY
Plasmid#193565PurposeExpresses human Clathrin Light Chain B (neuronal isoform) tagged with ShadowY in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsShadowYExpressionMammalianMutationNeuronal isoformPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
FKBP-EGFP-CLC
Plasmid#193567PurposeExpresses human Clathrin Light Chain B tagged with FKBP and mEGFP in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-FKBP-EGFP
Plasmid#193572PurposeExpresses human Clathrin Light Chain B tagged with FKBP and mEGFP in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLC-SNAP
Plasmid#193580PurposeExpresses human Clathrin Light Chain B tagged with SNAP-tag and mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsSNAP-tag and mEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-ShadowY-CLC
Plasmid#193552PurposeExpresses mouse Clathrin Light Chain A tagged with mEGFP and ShadowY in mammalian cells.DepositorAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLCdeltaN
Plasmid#193562PurposeExpresses human Clathrin Light Chain B truncation mutant (deleted 1-89 aa) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 1-89PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBY011-AMN1ko
Plasmid#183099PurposeS. cerevisiae Sigma1278b AMN1 gene knock out plasmid with KanMX selection marker.DepositorInsertAMN1 (left homology arm) - KanMX - AMN1 (right homology arm) (AMN1 Budding Yeast)
TagsKanMXExpressionBacterial and YeastMutationonly includes external sequences (504 bp each) as…PromoterURA3, TEF1Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-ELP-ddFLN4-XMod-Doc-HIS (wild type)
Plasmid#153439PurposeE. coli expression of Rc. XDocB wild-type construct containing ybbr tag, ELP linker and ddFLN4 fingerprint domain. This construct was designed for AFM measurements.DepositorInsertRc.XDocB
Tags3xELP linker, 6xHis, ddFLN4 fingerprint domain, a…ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hERG1a S631A
Plasmid#53058PurposeExpresses alpha subunit of S631A hERG1a K channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily H member 2 (KCNH2 Human)
UseXenopus oocyte expressionMutationchanged Serine 631 to AlaninePromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBp-FGFR2c-E471Q
Plasmid#45704DepositorAvailable SinceJune 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 BD (522-645, C643A)/pET28HMT
Plasmid#111073PurposeProtein expression in E.ColiDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
TagsHis Tag and MBP tagExpressionBacterialMutationKv7.4 BD (522-645, C643A)PromoterT7AvailabilityAcademic Institutions and Nonprofits only -
Kv7.4 (1-645, Δ368-492)/pcDNA3.1
Plasmid#111454PurposeElectrophysiology in HEK cellDepositorInsertpotassium voltage-gated channel subfamily KQT member 4 isoform a [Homo sapiens] (KCNQ4 Human)
ExpressionMammalianMutationKv7.4 (1-645, Δ368-492), C643AAvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286D/T305A/T306A)
Plasmid#127392PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286D/T305A/T306A)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to Aspartic acid and Threon…PromoterpCAGAvailable SinceJuly 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbr-HIS-ELP-ddFLN4-I27-XMod-Doc (wild type)
Plasmid#153442PurposeE. coli expression of Rc. XDocB wild-type construct containing ybbr tag, ELP linker and ddFLN4 and I27 fingerprint domains. This construct was designed for AFM measurements.DepositorInsertRc.XDocB
Tags3xELP linker, 6xHis, Titin I27, ddFLN4 fingerprin…ExpressionBacterialPromoterT7 promoterAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-GST-Nter-GWs-Lox (VE5586)
Plasmid#163766PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter GST tag under the pH promoter.DepositorInsertN-terminal GST tag
TagsGST TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_PH-6His-Nter-GWs-Lox (VE5587)
Plasmid#163768PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 6 His tag under the pH promoter.DepositorInsertN-terminal 6His tag
Tags6 His TagExpressionInsectPromoterPHAvailable SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-10His-Cter (VE5631)
Plasmid#161802PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter10His tag under the p10 promoter.DepositorInsertC-terminal 10 His tag
Tags10 HisExpressionInsectPromoterp10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only