We narrowed to 3,403 results for: aaas
-
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only
-
lentiCRISPRv2_RB1#1
Plasmid#174150PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-mTagBFP2-rMPC1 shRNA
Plasmid#229016PurposeExpression of an shRNA construct that knocks down rat MPC1. This plasmid also encodes a blue fluorescent protein tag to verify transfectionDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_1
Plasmid#232309PurposeHuman ETFDH Gene Knockout (gRNA 1)DepositorInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_2
Plasmid#232313PurposeMouse Etfdh Gene Knockout (gRNA 2)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
mEtfdh CRISPR_1
Plasmid#232312PurposeMouse Etfdh Gene Knockout (gRNA 1)DepositorInsertEtfdh-targeting gRNA (Etfdh Mouse)
UseLentiviralAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_2
Plasmid#232310PurposeHuman ETFDH Gene Knockout (gRNA 2)DepositorInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-PPP2R1A
Plasmid#116777PurposeLentiviral expression of PPP2R1ADepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hCRY1 c-term
Plasmid#179453PurposeLentiviral Crispr/Cas9 plasmid targeting hCRY1 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human CRY1
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA LINE1
Plasmid#223699PurposegRNA of dPspCas13b-FTO targeting LINE1DepositorInsertgRNA target sequence for LINE1
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAP1-2
Plasmid#125838PurposeKO BAP1 geneDepositorInsertBAP1 (BRCA1 associated protein 1) (BAP1 Human)
UseLentiviralAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasper4-g-osk-TRICK
Plasmid#71244Purposeoskar translation biosensor with 12x copies of modified PP7 stem loops and 6xMS2 stem loops. . full genomic region, used for P element-mediated germline transformation in Drosophila.DepositorInsertoskar (osk Fly)
UseP element-mediated germline transformationTags12xPP7 and 6xMS2ExpressionInsectPromoteroskAvailable SinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D
Plasmid#110302PurposeExpresssion of Cas9-T2A-puromycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
CDK2 gRNA (BRDN0001147786)
Plasmid#77192Purpose3rd generation lentiviral gRNA plasmid targeting human CDK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001144943)
Plasmid#75942Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LMPd Ametrine Got2 shRNA#3
Plasmid#220593PurposeRetroviral vector with Ametrine marker for expression shRNA with an "UltramiR" microRNA scaffoldDepositorInsertGot2 shRNA (Got2 Mouse)
UseRetroviralAvailable SinceJune 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
shBCL2L1 # 2
Plasmid#42552DepositorAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only