We narrowed to 7,278 results for: cas9 plasmid
-
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Blast
Plasmid#118055PurposeUsed for expression of sgRNA in mammalian cellsDepositorTypeEmpty backboneExpressionMammalianAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Cas9-gRNA-GFP
Plasmid#124770Purpose3rd generation lentiviral plasmid encoding Cas9, GFP, and a gRNA backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_NC_chr1
Plasmid#214688PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro_hs_TP73
Plasmid#214689PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralMutationPuromycin resistance cassette has silent mutation…Available SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Hygro
Plasmid#127763PurposeUsed for expression of sgRNA in mammalian cellsDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-dCas9-VPR-wpA-pPuroTK
Plasmid#214127PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertdCas9-VPR
UseCRISPRExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUAS:Cas9T2AGFP;U6:sgRNA1;U6:sgRNA2
Plasmid#74009PurposeTissue-specific knock-out in zebrafish, Cas9 and GFP driven by a UAS promoterDepositorInserts5x UAS
Cas9
T2A
GFP
U6 promoter
UseCRISPRAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only