We narrowed to 923 results for: tac promoter
-
Plasmid#236164PurposePlasmid encoding the SCN1A-117 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-117-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF10 CMV-TO-SCN1A-372-NZF
Plasmid#236171PurposePlasmid encoding the SCN1A-372 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-372-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW172 CMV-TO-UTRN-14ZF-VP64 (FLP-IN)
Plasmid#236160PurposePlasmid encoding the UTRN-14 zinc finger array attached by a GS linker to the VP64 transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUTRN-14ZF-VP64
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF4 CMV-TO-SCN1A-383-NZF
Plasmid#236165PurposePlasmid encoding the SCN1A-383 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-383-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF5 CMV-TO-SCN1A-472-NZF
Plasmid#236166PurposePlasmid encoding the SCN1A-472 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-472-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF9 CMV-TO-SCN1A-371-NZF
Plasmid#236170PurposePlasmid encoding the SCN1A-371 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-371-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF2 CMV-TO-SCN1A-374-NZF
Plasmid#236163PurposePlasmid encoding the SCN1A-374 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-374-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW171 CMV-TO-UTRN-43ZF-VP64 (FLP-IN)
Plasmid#236161PurposePlasmid encoding the UTRN-43 zinc finger array attached by a GS linker to the VP64 transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUTRN-43ZF-VP64
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF1 CMV-TO-SCN1A-377-NZF
Plasmid#236152PurposePlasmid encoding the SCN1A-377 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-377-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW368 CMV-TO-UtroUpZF-deImmunLink-NZF(FLP-IN)
Plasmid#236154PurposePlasmid encoding the UtroUp zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUtroUpZF-deImmunLink-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF6 CMV-TO-SCN1A-114-NZF
Plasmid#236167PurposePlasmid encoding the SCN1A-114 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-114-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF7 CMV-TO-SCN1A-140-NZF
Plasmid#236168PurposePlasmid encoding the SCN1A-140 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-140-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF8 CMV-TO-SCN1A-475-NZF
Plasmid#236169PurposePlasmid encoding the SCN1A-475 zinc finger array attached by a GS linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-475-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBP-J23108
Plasmid#72964PurposeLevel 0 - J23108 standard iGEM promoter (5' CTAT/3' GTAC fusion)DepositorInsertJ23108 promoter
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-J23114
Plasmid#72965PurposeLevel 0 - J23114 standard iGEM promoter (5' CTAT/3' GTAC fusion)DepositorInsertJ23114 promoter
UseSynthetic BiologyTagsExpressionMutationCAT gene - C435G (nucleotide) - silent mutagenesi…PromoterAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EW490 CMV-TO-UTRN-14ZF-realdeImmLink-NZF (FLP-IN)
Plasmid#236149PurposePlasmid encoding the UTRN-14 zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUTRN-14ZF-deImmLink-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMG051 MBP-β-catenin-His, GST-CK1α
Plasmid#154072PurposeCo-expresses MBP-β-catenin-His (human β-catenin as a fusion protein with MBP and His- tags) and GST_CK1α in E.coli to produce primed MBP-β-catenin-HisDepositorUseTagsGST, His6, and MBPExpressionBacterialMutationPromoterTacAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS426-HsFECH
Plasmid#174524PurposeExpresses human ferrochelatase (FECH) in yeastDepositorInsertFECH with yeast HEM15 promoter and terminator (FECH Human, Budding Yeast, Synthetic)
UseTagsExpressionYeastMutationLacks original mitochondrial targeting sequence (…PromoterHEM15 (yeast, 257 bp)Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
IL2-AHDC2-2A-CherryRhoAQ63L in pmCherryN1
Plasmid#187292PurposeExpress pmCherry-IL2-AH-deltaC2-2A-RhoA Q63LDepositorUseTagsmCherryExpressionMammalianMutationAH-deltaC2, RhoA Q63LPromoterCMVAvailable SinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only