We narrowed to 3,403 results for: aaas
-
Plasmid#75254Purposeretroviral shRNA vector against human BCL10, expresses GFP for transduction controlDepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only
-
RalA (G23V)(mature peptide)-pcw107-V5
Plasmid#64643Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
RalA (G23V)(mature peptide)-pcw107
Plasmid#64642Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
JAK2 (V617F)-pcw107-V5
Plasmid#64610Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1#1/Cre
Plasmid#173639PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Keap1 (Keap1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001145848)
Plasmid#77166Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrca2#1/Cre
Plasmid#173627PurposeExpresses a Brca2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Brca2 (Brca2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
CDK12 gRNA (BRDN0001147156)
Plasmid#75915Purpose3rd generation lentiviral gRNA plasmid targeting human CDK12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgBrca2#2/Cre
Plasmid#173628PurposeExpresses a Brca2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Brca2 (Brca2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
TGFbetaR1 (T204D)-pcw107-V5
Plasmid#64629Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertTGFBR1 (transcript variant 1) (TGFBR1 Human)
UseLentiviralTagsV5MutationT204DPromoterPGKAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PPP2R1A_WT
Plasmid#81760PurposeGateway Donor vector containing PPP2R1A , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
EXOSC10 gRNA (BRDN0001149316)
Plasmid#77990Purpose3rd generation lentiviral gRNA plasmid targeting human EXOSC10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Notch3 intracellular domain-pcw107-V5
Plasmid#64623Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSMPUW-miR-124-GFP-Puro
Plasmid#117321PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseLentiviralTagsGFP-PuroExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
DYRK1A gRNA (BRDN0001145031)
Plasmid#76755Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_PPP2R1A_WT
Plasmid#81944PurposeGateway Donor vector containing PPP2R1A, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
SRC gRNA (BRDN0001145402)
Plasmid#75650Purpose3rd generation lentiviral gRNA plasmid targeting human SRCDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only