We narrowed to 15,445 results for: grn
-
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
CCND2 targeting gRNA
Plasmid#215318PurposeExpresses gRNA targeting CCND2 and pSpCas9(BB)-2A-GFP in mammalian cells from the px458 vector.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-gRNA
Plasmid#215547PurposegRNA targeting B2M to introduce splice donor mutation on the first intron of the locusDepositorInsertB2M (B2M Human)
UseCRISPRAvailable sinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-ERCC1 gRNA1
Plasmid#211630PurposesgRNA-1 against ERCC1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA ERCC1
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-CHMP4B gRNA2
Plasmid#211629PurposesgRNA-2 against CHMP4BDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA CHMP4B
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-CHMP4B gRNA1
Plasmid#211628PurposesgRNA-1 against CHMP4BDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA CHMP4B
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#1
Plasmid#189987PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralAvailable sinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #2
Plasmid#202519PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; EGF_gRNA
Plasmid#199333PurposepDEL158; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 EGF sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertszCREST3
Cas9
nrg1 EGF sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2T-gRNA2
Plasmid#196253PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA for guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9337 (pgRNA_IV-1_NatMX)
Plasmid#161590PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only