We narrowed to 5,340 results for: 290
-
Plasmid#77418Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PIK3CA gRNA (BRDN0001145530)
Plasmid#77416Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-TbID-LBR
Plasmid#175100PurposeLentiviral expression of V5-TbID-tagged mouse LbrDepositorAvailable SinceNov. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A-PIK3CA E545K
Plasmid#180032PurposeEntry vector of PIK3CA E545K for gateway cloning.DepositorAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIK3CA gRNA (BRDN0001146960)
Plasmid#77415Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGal-Trans-Myc-HA-GFP11-KDEL
Plasmid#177724PurposeER protein collagen beta (1-O) galactosyltransferase with a C-terminal Myc tag, an HA tag and the eleventh β-strand of GFPDepositorInsertcollagen beta(1-O)galactosyltransferase 1 (COLGALT1 Human)
TagsGFP11, HA, KDEL, and MycExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-335-3p
Plasmid#103446PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-335-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-335-3p target (MIR331 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-NSD3-short del(1-100)
Plasmid#72547Purposeexpresses 3*FLAG tagged human NSD3-short with 1-100 aa deletionDepositorInsertNSD3-short (NSD3 Human)
UseRetroviralTags3*FLAGExpressionMammalianMutation1-100 aa deletionPromoterLTRAvailable SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
AT4G29450 O1_pECIA2
Plasmid#114961PurposeBait vector AT4G29450 O1_pECIA2 should be used with prey vector AT4G29450 O1_pECIA14.DepositorInsertAT4G29450 (AT4G29450 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-339-3p
Plasmid#103452PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-339-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-339-3p target (MIR338 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
AT4G29450 O1_pECIA14
Plasmid#114761PurposePrey vector AT4G29450 O1_pECIA14 should be used with bait vector AT4G29450 O1_pECIA2.DepositorInsertAT4G29450 (AT4G29450 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-340-5p
Plasmid#103459PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-340-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-340-5p target (MIR340 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PIK3CA gRNA (BRDN0001146906)
Plasmid#77417Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_6xHis-FKBP8(1-391aa)-thrombin-GST
Plasmid#227712PurposeExpression of recombinant protein for purificationDepositorInsertFKBP8(1-391aa) (FKBP8 Human)
ExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
gamma-tubulin (1-335)
Plasmid#226519PurposeExpressing a fragment of gamma-tubulin containing gamma-tubulin GTPase domainDepositorInsertTUBG1 N-terminal amino acids 1-335 (TUBG1 Human)
UsePcdna3.1ExpressionMammalianMutationDeleted amino acids 334-451 and introduced the fo…Available SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-NGN2-AroLITE_A
Plasmid#215608PurposeFor overexpression of Gal4-DBD NGN2 AroLITEDepositorInsertNGN2 AroLITE (NEUROG2 Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-NGN2-AroPERFECT
Plasmid#215609PurposeFor overexpression of Gal4-DBD NGN2 AroPERFECTDepositorInsertNGN2 AroPERFECT (NEUROG2 Human)
ExpressionMammalianAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-TetON-mEGFP-NGN2_AroLITE_A
Plasmid#215611PurposeFor integration of NGN2 AroLITE T2A mEGFPDepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-TetON-mEGFP-NGN2_AroPERFECT
Plasmid#215612PurposeFor integration of NGN2 AroLITE T2A mEGFPDepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only