We narrowed to 4,067 results for: SPL
-
Plasmid#52298PurposeReporter for normal human GPR56 exon 1m promoter activity. Human GPR56 e1m promoter (chr16:56,230,630-56,230,943 (hg18)) was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 124A/125A
Plasmid#164523PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions R124A/K125A)DepositorInsertNSP1 124A/125A (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3E-hGPR56 e1m promoter perisylvian polymicrogyria
Plasmid#52299PurposeReporter for mutated human GPR56 exon 1m promoter activity. It contains a 15-bp deletion in a conserved noncoding element. The mutated human GPR56 e1m promoter was inserted into pGL3E.DepositorInsertADGRG1 adhesion G protein-coupled receptor G1 (ADGRG1 Human)
UseLuciferaseMutation15-bp deletion in the promoterPromoterHuman GPR56 e1m promoterAvailable SinceApril 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-Lbr-V5-mCherry
Plasmid#235093PurposeLbr mCherry fusion protein with MCP domainDepositorAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTT3-ecdCD80-ST3-His
Plasmid#210665PurposeExpression of the extracellular domain of human CD80 fused to Spytag003 + Histag in HEK293 (or similar)DepositorInsertExtracellular domain of human CD80 fused to Spytag003 and Histag (CD80 Human)
TagsHistag and Spytag003ExpressionMammalianPromoterCMVAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
TR01F/hFGFR3-G380R-V5
Plasmid#214908Purposefor PiggyBac mediated integration and stable expression of hFGFR3-G380R variant that is associated with AchondroplasiaDepositorInsertFGFR3 (FGFR3 Human)
TagsV5/HisExpressionMammalianMutationG380R substitutionPromotertruncated CMV promoterAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLED.RAB
Plasmid#193015PurposePhotoreceptor-specific reporter (CBh promoter, Atp1b2 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Venus-BimEL-4E-pEGFP-C1
Plasmid#166742PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, BimEL with mutation in BH3 domain to disrupt binding anti-apoptotic proteinsDepositorInsertBimEL-4E (Bcl2l11 Mouse)
TagsVenusExpressionMammalianMutation4 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus-BimL-4E-pEGFP-C1
Plasmid#166741PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, BimL with mutation in BH3 domain to disrupt binding anti-apoptotic proteinsDepositorInsertBimL-4E (Bcl2l11 Mouse)
TagsVenusExpressionMammalianMutation4 hydrophobic residues in the BH3 region mutated …PromoterCMVAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-CTID195-GSQ-SUMO1nc-PURO
Plasmid#208035PurposeEnables inducible expression of C-terminal Split-TurboID-fused SUMO1nc, to perform SUMO-ID; nc = non-cleavable mutation; selection with puromycinDepositorInsertSUMO1nc (SUMO1 Human)
UseLentiviralTagsMyc, C-terminal Split-TurboIDMutationQ94P Mutation near C-terminus suppresses cleavage…PromotertetO/UBCAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFC34K LgBiT TK-Neo Human collagen type IV alpha 5 chain (COL4A5)
Plasmid#229770PurposeHuman Col4A5 tagged at C-terminal with LgBiT to be used with C-tagged SmBiT hCol4A3 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFC36K SmBiT TK-neo Human collagen type IV alpha 3 chain (COL4A3)
Plasmid#229769PurposeHuman Col4A3 tagged at C-terminal with SmBiT to be used with C-tagged LgBiT hCol4A5 and Flag-tagged hCol4A4 in Nanobit assay systemDepositorAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist-CMV-HDGFL2_Cryptic_TwinstrepTEV_6xHis
Plasmid#232344PurposeExpresses human HDGFL2 protein with TDP-43 regulated cryptic exon, along with an N-terminal twinstrep tag + TEV protease site and C-terminal His-tagDepositorInsertHDGF Like 2 (HDGFL2 Human)
TagsGGGS linker, 6xHis and Twin-strep, TEV protease s…ExpressionMammalianMutationTDP-43 regulated cryptic exonAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only