We narrowed to 3,225 results for: bad
-
Plasmid#88999PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.2 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEVOL-AcKRS-CloDF
Plasmid#127415PurposeMutant of mmPylRS designed for incorporation of non-canonical amino acids (acyl-lysine derivatives) in to M13 bacteriophageDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialPromoteraraBADAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR-SF61
Plasmid#163916PurposetRNA synthetase/tRNA pair for the in vivo incorporation of para-Pentafluorosulfanyl-Phenylalanine, into proteins in E. coli in response to the amber (TAG) codonDepositorInsertSF5Phe tRNA synthetase
ExpressionBacterialPromoteraraBADAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEDF-PhdRS
Plasmid#127445PurposeDouble mutant of wild type mmPylRS designed for incorporation of non-cannonical amino acids in to M13 bacteriophageDepositorInsertPyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
ExpressionBacterialMutationN346A-C348A mutations on PylRSPromoteraraBADAvailable SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0-i
Plasmid#194639PurposeEmpty pAGE2.0 plasmid with pBAD inducible promoterDepositorTypeEmpty backboneUseSynthetic Biology; Diatom expressionExpressionBacterial and YeastAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
N-BLa 1.1
Plasmid#88994PurposeBLaTM, a genetic tool to measure homo- and heterotypic transmembrane helix-helix interactions. Plasmid encoding the 1.1 fusionprotein containing the N-terminal fragment of the split β-lactamase.DepositorInsertN-BLa 1.1 fusion protein
TagsFlagExpressionBacterialPromoteraraBADAvailable SinceMay 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3Sc
Plasmid#109365PurposeHuman rod opsin chimera with intracellular loop 3 from Scallop opsin with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBXNPHM3-Nb_MsbA#1
Plasmid#186428PurposePlasmid for bacterial expression of MsbA binding Nanobody Nb_MsbA#1DepositorInsertNanobody Nb_MsbA#1
UseAffinity Reagent/ AntibodyTags3C cleavage site, His Tag, Maltose Binding Protei…PromoterpBADAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9GG
Plasmid#131009PurposeBackbone plasmid for generating CRISPR arrays for SpCas9 using CRATES. Contains a direct repeat and a RFP-dropout cassette.DepositorInsertsdirect repeat of SpCas9
promoter PJ23119
mRFP expression cassette
UseCRISPRExpressionBacterialPromoterBba_R0040 TetRAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3Am
Plasmid#109364PurposeHuman rod opsin chimera with intracellular loop 3 from Amphioxus opsin 1 with 1D4 tagDepositorInsertRod opsin chimera with Amphioxus Opsin1 intracellular Loop 3 (RHO Human, Branchiostoma belcheri)
Tags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN(GFP)-HA-Tbkbp1
Plasmid#125177PurposeRetroviral expression of mouse Tbkbp1DepositorAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLN43 - pBait-1xMS2-7GC[chiP-5']-TtrpA
Plasmid#222404Purposearabinose-induced synthesis of a hybrid RNA containing a 5' MS2 hairpin, E. coli chiP 5'UTR insert between XmaI and HindIII sites, surrounded by a 7bp GC clamp, and followed by a 3' trpA terminator.DepositorInsert5’UTR of chiP (-98 to +12, relative to AUG) (chiP E. coli)
Tags1xMS2 hairpin, 7GC clamp, TtrpA terminatorExpressionBacterialPromoterpBADAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-Apr
Plasmid#208000PurposeExpresses all necessary components of Type I-C CRISPR-Cas systemDepositorAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSG068
Plasmid#214259PurposepJN105 with PaftsH2SD and PaFtsH1 ORF cloned between NheI/XbaIDepositorInsertCore genome PaFtsH1 proteinase from Pseudomonas aeruginosa SG17M
ExpressionBacterialMutation18 nucleotide 5' of the start codon (Shine-D…PromoteraraBAD promoterAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE_RBS3_CB2
Plasmid#201533PurposeExpressing synthetic overlapping gene, ilvA-relE with internal RBS modification. Evolved strain with lower ilvA-relE expression. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE_RBS3_CB2
UseSynthetic BiologyMutationrhaR L128+1bp (frameshift), ilvA G455CPromoterPrhaBAD (rhamnose)Available SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJUMP24_T24_pRham-ilvA-relE_RBS3_CB4
Plasmid#201535PurposeExpressing synthetic overlapping gene, ilvA-relE with internal RBS modification. Evolved strain with lower ilvA-relE expression. Origin pRO1600/ColE1 (E.coli - Pseudomonas shuttle)DepositorInsertilvA-relE_RBS3_CB4
UseSynthetic BiologyMutationrhaS ΔM1-H5, PrhaSR Δ179bpPromoterPrhaBAD (rhamnose)Available SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_+10D+7U
Plasmid#149393PurposeP. aeruginosa PA14 CRISPR2 locus, with 10bp addition downstream,and 7bp addition upstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation7bp inserted upstream, and 10bp inserted downstre…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_+10D+10U
Plasmid#149394PurposeP. aeruginosa PA14 CRISPR2 locus, with 10bp addition downstream,and 10bp addition upstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation10bp inserted upstream and downstream of the IHFp…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only