We narrowed to 5,900 results for: pCas
-
Plasmid Kit#1000000210PurposeToolkit contains Cas9-gRNA vectors, integration plasmids, and organellar localization markers as a set of plasmids for Cas9-mediated integration of tagged genes and markers into the yeast genome.DepositorAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDONR221_FLVCR1
Plasmid#131892PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertFLVCR1 (FLVCR1 Human)
ExpressionMammalianAvailable SinceOct. 9, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-FLVCR1_STOP
Plasmid#161058PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertFLVCR1 (FLVCR1 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Human sgRNA library Brunello in lentiCRISPRv2 (Lentiviral Prep)
Viral Prep#73179-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiCRISPRv2 (#73179). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2 plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2.DepositorAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPRmTmG2
Plasmid#69992PurposeThe CRISPR construct targets near the LoxP sites in Rosa-pCA-loxP-mTdtomato-loxP-mEGFP mice.DepositorInsertgRNA that targets near LoxP sites
Available SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
p44PPV-eGFP
Plasmid#241907PurposePart 2 of a two-plasmid PCA biosensor composed of the PcaV repressible PPV promoter upstream from a reporter gene (eGFP) on a second plasmidDepositorInsertHis6-eGFP
UseSynthetic BiologyMutationnoneAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCNICK
Plasmid#84653PurposeGenome editing for Lactobacillus casei Lc2WDepositorInsertsCas9 nickase
sgRNA
homology arms of LC2W_2179
UseCRISPRMutationD10AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSP02
Plasmid#117259PurposeGenome editing for Lactobacillus plantarum WCSF1DepositorInsertCas9, promotor P11-guide-RNA, homologous arms of Lp_0537
UseOtherAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHSB04X
Plasmid#117258PurposeGenome editing for Lactobacillus brevis ATCC367DepositorInsertCas9, promotor PslpA-guide-RNA, homologous arms of Lb_1019
UseOtherAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
p131CB10-tphKAB
Plasmid#241911PurposeTPA catabolic operon under the control of a PCA inducible biosensorDepositorInserttphK, tphA2, tphA3, tphB, tphA1
UseSynthetic BiologyMutationnoneAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pISFba1
Plasmid#226820PurposeExpressing ISEre1 controled by pCas promoter, λ-red recombinase, SacB and ISFba1 guide RNA targeting pMB1 oriDepositorInsertISFba1
ExpressionBacterialAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pISEre1
Plasmid#226819PurposeExpressing ISEre1 controled by pCas promoter, λ-red recombinase, SacB and ISEre1 guide RNA targeting pMB1 oriDepositorInsertISEre1
ExpressionBacterialAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKB12 (pDEST-DHFR F[3] C-term, HygR)
Plasmid#210486PurposepDEST vector to tag gene of interest with DHFR F[3] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only