We narrowed to 7,026 results for: ust
-
Plasmid#203292PurposeOverexpress HLA alleleDepositorInsertA*68:01:01 (HLA-A Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Foxf2 pcDNA HisC
Plasmid#122121PurposeExpression of Foxf2 in mammalian cellsDepositorInsertFoxf2 (Foxf2 Mouse)
UseTags6xHis and ExpressExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV FLIPi P2G_Thy1.1 Dbl (p53,PTEN)
Plasmid#19746DepositorInsertoligo targeting p53 and PTEN (Pten Mouse)
UseCre/Lox, RNAi, and RetroviralTagsExpressionMammalianMutationPromoterAvailable sinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-Bmpr2-Δ17
Plasmid#49380PurposeInsert is a fragment of the Bmpr2 3'-UTR that contains a mutated miR-17 binding site. To be used for 3'UTR assay.DepositorInsertBmpr2 (BMPR2 Mouse, Human)
UseLuciferaseTagsExpressionMutationchanged nucleotides AC to TG at bp 7347-7348PromoterHuman phosphoglycerate kinase (PGK) promoterAvailable sinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR P4-P1R-V5-6xHis
Plasmid#48346PurposeContributes the coding sequence of a V5-6xHis epitope tags cassette as the 5’-module during MultiSite Gateway-cloning of chimeric cDNAs encoding three-part fusion proteins.DepositorInsertV5 and 6xHis epitope tags cassette
UseGateway entry cloneTagsExpressionMutationContains a Kozak sequence and initiation codon up…PromoternoneAvailable sinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisTagsExpressionMutationPromoterAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
His10-B1 Integrin
Plasmid#186139PurposeFor expression of recombinant his10-beta1 integrin cytosolic domain in bacteriaDepositorInsertITGB1 (ITGB1 Human)
UseTagsMBP + uncleavable His10ExpressionBacterialMutationPromoterLacAvailable sinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-MPP8-112–858_Flag2-Blast
Plasmid#175039PurposeMammalian expression of mMPP8 (E112 to Q858) with C-terminal Flag2 tagDepositorInsertMphosph8 (Mphosph8 Mouse)
UsePiggybacTagsFlag2ExpressionMammalianMutationExpression of MPP8 protein from amino acid positi…PromoterCAGAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-MPP8-1–729_Flag2-Blast
Plasmid#175040PurposeMammalian expression of mMPP8 (M1 to E729) with C-terminal Flag2 tagDepositorInsertMphosph8 (Mphosph8 Mouse)
UsePiggybacTagsFlag2ExpressionMammalianMutationExpression of MPP8 protein from amino acid positi…PromoterCAGAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB-MPP8-∆ARD_Flag2-Blast
Plasmid#175041PurposeMammalian expression of mMPP8 (deletion from D570 to K718) with C-terminal Flag2 tagDepositorInsertMphosph8 (Mphosph8 Mouse)
UsePiggybacTagsFlag2ExpressionMammalianMutationExpression of MPP8 protein with deletion of the a…PromoterCAGAvailable sinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2-cryR;dll4CE2-P1Egfp
Plasmid#90147Purposecontains dll4 enhancer 2 sequence, and dll4 specific gene promoter driving expression of eGFPDepositorInsertdll4E2P1Egfp (dll4 Zebrafish)
UseTagsEGFPExpressionBacterialMutationPromoterAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pVL44 - pVND7>>
Plasmid#116010Purposedestination vector for GreenGate cloning method, contains 2x a set of modules from A-F, "Driver line", tissues-specific promoter, Dex-inducible mTurquoise2 expressionDepositorInsertpVND7:GR-LhG4:tVND7:F-H adapter-H-A adapter::pOp4:SP(ER)-mTurquoise2-HDEL:tUBQ10::SulfR
UseTagsHDEL and SP(ER)ExpressionPlantMutationPromoterAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-MKLP1 S708/710A
Plasmid#70153Purposemammalian expression of MKLP1 with an eGFP fusion and S708A/S710A mutationsDepositorInsertMKLP1 (KIF23 Human)
UseTagseGFPExpressionMammalianMutationS708A, S710APromoterCMVAvailable sinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
C-His-GvpC-TEV
Plasmid#153296PurposeExpresses TEV-sensitive variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertTEV-sensitive Gas vesicle protein C (his-tagged)
UseTagsHis-tagExpressionBacterialMutation1) 21 bp TEV recognition and cleavage site flanke…PromoterT7Available sinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
N-His-GvpC-ssrA
Plasmid#153297PurposeExpresses ClpXP-degradable variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertGas vesicle protein C (with N-terminal his-tag and C-terminal ssrA tag)
UseTagsHis-tag and ssrA tagExpressionBacterialMutation1) N-terminal 6xHis tag flanked by 1x glycine res…PromoterT7Available sinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Foxf1 pGEX4T1
Plasmid#122213PurposeExpression of Foxf1 as a GST fusion protein in bacteriaDepositorInsertFoxf1 (Foxf1 Mouse)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmirGLO-Bmpr2-Δ19
Plasmid#49381PurposeInsert is a fragment of the Bmpr2 3'-UTR that contains a mutated miR-19 binding site. To be used for 3'UTR assay.DepositorInsertBmpr2 (BMPR2 Mouse, Human)
UseLuciferaseTagsExpressionMutationchanged nucleotides TG to AC at bp 7344-7345PromoterHuman phosphoglycerate kinase (PGK) promoterAvailable sinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAM4663
Plasmid#85126PurposeNSIII -Cm-PkaiB-luc+ (firefly) vector constructed by seamless cloning with Cm casette codon optimized for S7942. PkaiB-luc+ amplified from pAM2105.DepositorInsertPkaiB-luciferase
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-MKLP1 S708A
Plasmid#70146Purposemammalian expression of MKLP1 with an eGFP fusion and an S708A mutationDepositorInsertMKLP1 (KIF23 Human)
UseTagseGFPExpressionMammalianMutationS708APromoterCMVAvailable sinceNov. 4, 2015AvailabilityAcademic Institutions and Nonprofits only