We narrowed to 3,225 results for: bad
-
Plasmid#203712PurposeConstitutive mammaliam expression of human NKX6-2 cDNA fused with the Venus fluorescent proteinDepositorAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pCLXSN(GFP)-HA-Tbkbp1 1-280
Plasmid#125178PurposeRetroviral expression of mouse Tbkbp1 (1-280)DepositorInsertTbkbp1 (Tbkbp1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationContains amino acids 1-280PromoterCMVAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLXSN(GFP)-HA-Tbkbp1 1-330
Plasmid#125179PurposeRetroviral expression of mouse Tbkbp1 (1-330)DepositorInsertTbkbp1 (Tbkbp1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationContains amino acids 1-330PromoterCMVAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas-Cas12m
Plasmid#192274PurposeEncodes MmCas12m under a constitutive promoterDepositorInsertMmCas12
UseCRISPRExpressionBacterialPromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m
Plasmid#192275PurposeEncodes MmdCas12m (D485A) under a constitutive promoterDepositorInsertMmdCas12m
UseCRISPRExpressionBacterialMutationD485APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-3UAG
Plasmid#82501PurposeExpresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153DepositorInsertGreen Fluorescence Protein with 3 UAG codons
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3, …PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28-HADH2
Plasmid#67863Purposebacterial expression of SDR5C1 (HSD17B10), full coding sequence + N-term. His tag (thrombin site)DepositorAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
b2AR->M71-IRES-tauGFP-ACNF TV
Plasmid#105198Purposetargeting vector to generate a replacement of CDS of M71 with CDS of mouse beta2-adrenergic receptor with expression of tauGFP.DepositorAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p-OiRS3GG
Plasmid#98589PurposeExpresses default target RNA (gI intron) and pheS cassette (in place of an antisense RNA probe, for golden gate cloning) in E. coli (kanR).DepositorInsertsgroup I intron
PheS cassette to be selectively replaced by unique asRNA probes
ExpressionBacterialPromoterpBAD and pLtetOAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tau BA 12->10 N296N
Plasmid#203383PurposeFor transfection and in vitro assayDepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2-Venus R200W
Plasmid#209179PurposeMammalian expression of SPAX8-related missense mutation (R200W) in human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (R200W) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationNKX6-2 (R200W)PromoterCMVAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-196)-Venus
Plasmid#209182PurposeMammalian expression of human NKX6-2 cDNA SPAX8-related truncated mutation containing the amino acids 1 to 196; fused with the green fluorescent protein Venus allowing the use of fluorescent based protocols.DepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2-Venus L163V
Plasmid#209178PurposeMammalian expression of SPAX8-related missense mutation (L163V) in human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (L163V) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationNKX6-2 (L163V)PromoterCMVAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-188)-Venus
Plasmid#203714PurposeSPAX8-related truncated mutation (E189*) containing the amino acids 1 to 188 of human NKX6-2 fused with the Venus fluorescent proteinDepositorInsertNKX6-2 (1-188) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationdeletion of amino acids 189-277PromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2(1-40)-Venus
Plasmid#203713PurposeSPAX8-related truncated mutation (K41*) containing the amino acids 1 to 40 of human NKX6-2, fused with the Venus fluorescent protein.DepositorInsertNKX6-2 (1-40) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationdeletion of amino acids 41-277PromoterCMVAvailable SinceSept. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-Cas12m-ΔZF
Plasmid#192276PurposeEncodes MmCas12m ΔZF (H549A, C552A) under a constitutive promoterDepositorInsertCas12m ΔZF
UseCRISPRExpressionBacterialMutationH459A, C552APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas-dCas12m-ΔZF
Plasmid#192277PurposepCas-dCas12m-ΔZF (D485A, H549A, C552A) under a constitutive promoterDepositorInsertMmdCas12m ΔZF
UseCRISPRExpressionBacterialMutationD485A, H549A, C552APromoterPJ23108Available SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRha-ABE8e-SpCas9-NG
Plasmid#201190PurposeExpresses the base editor ABE8e-SpCas9-NG in bacterial cellsDepositorInsertABE8e-SpCas9-NG
Tags8xHIS and BP-NLSExpressionBacterialPromoterpRhaBADAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only