We narrowed to 8,917 results for: c myc plasmid
-
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
Plas-CRISPR_reporter
Plasmid#157658PurposeCRISPR reporter for mRNA quantification, integrative plasmid into NPR2 geneDepositorInsertdCAS9-VP64, mCherry, KanMX
UseInsert storage (replicative in e. coli)MutationN28D in mCherry- please see depositor comments be…Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-L1374
Plasmid#226278PurposePlasmid expressing the SSD1 allele from L-1374, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-NCYC110
Plasmid#226273PurposePlasmid expressing the SEC22 allele from NCYC110, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-L1374
Plasmid#226271PurposePlasmid expressing the SEC22 allele from L-1374, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-UWOPS872421
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorInsertSEC22 (SEC22 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorInsertSSD1 (SSD1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTi4.0_SpdCas9_pmcDA1
Plasmid#204613PurposeCRISPR cytosine deaminase integrative plasmid for Mycoplasma gallisepticumDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT85_SpdCas9_pmcDA1
Plasmid#204614PurposeCRISPR cytosine deaminase integrative plasmid for Mycoplasma bovisDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXJ42-p200 CUX1
Plasmid#100813PurposePlasmid vector expressing human p200 CUX1 (amino acids 1-1505 of P39880), with an N-terminal Myc tag and a C-terminal HA tagDepositorInsertp200 CUX1 (CUX1 Human)
UseNote that this plasmid does not have an sv40 oriTagsHA and MycExpressionMammalianAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSN29
Plasmid#100114Purposeexpresses a chimeric cMYC-repressor fusionDepositorUseLentiviralExpressionMammalianAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-mStayGold-polyA-Hygro HR
Plasmid#229679PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with monomeric StayGold. Contains a hygromycin resistance cassette for selection of edited cellsDepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pbG-APRT-J-u32uni-PdTKmCh
Plasmid#107279PurposeAPRT c.407T>C (APRT*J) donor vector with unilateral microhomologyDepositorInsertsMutationc.402A>T, c.407T>CAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only