We narrowed to 8,876 results for: sgrna
-
Plasmid#196990PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with KDR sgRNADepositorInsertVEGFR2
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7
Plasmid#226915PurposeExpresses TadA8e and Sp cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSp Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pW188-lenti-spsgRNA-lacZ-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170813PurposeLentiviral vector to co-express a lacZ control spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sgBB: pHR-hU6-CasMINI sgRNA_#2; EF1a-Puro-T2A-BFP- WPRE
Plasmid#180280PurposeThe CasMINI sgRNA cloning backbone with sites 'BsmBI' for inserting new guide sequences.DepositorInsertCasMINI sgRNA (backbone) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX602-AAV-TBG::NLS-SaCas9-NLS-HA-OLLAS-bGHpA;U6::BsaI-sgRNA
Plasmid#61593PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTagsHA, NLS, and OLLAS tagExpressionMammalianMutationK175R and K736R (deUb mutations)Available SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only