We narrowed to 11,032 results for: sgRNA
-
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-2 lentiCRISPR v2 plasmid
Plasmid#192228Purposelentiviral vector expressing sgRNA-2 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-2 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-1 lentiCRISPR v2 plasmid
Plasmid#192227Purposelentiviral vector expressing sgRNA-1 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-1 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-AK057321-SVA-mcherry
Plasmid#202821PurposeLentiviral vector modified to express two sgRNAs that delete the SVA within the SVA-lncRNA AK057321 gene (exon 3) with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within SVA-lncRNA AK057321 gene
UseLentiviralExpressionMammalianPromoterU6 (two)Available sinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFH51
Plasmid#128213Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH71
Plasmid#128214Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH75
Plasmid#128224Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmcGAS
Plasmid#208385PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine cGAS gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc-sgmSTING
Plasmid#208386PurposeLentiviral vector expressing Cas9, GpNLuc, and sgRNA targeting murine STING gene.DepositorAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCC_07 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-dxCas9-NLS-VPR-2A-Puro-WPRE
Plasmid#139092PurposeExpresses human codon-optimized inactive xCas9 3.7 fused to a transcriptional activator VPR in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertdxCas9 3.7-VPR
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T, R324L,S409I, E480K, E543D, M6…Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA104
Plasmid#245326PurposeCas9 CRISPRa positive control guide; targets CD4DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP17_Lenti α-syn
Plasmid#239419PurposeLentiviral plasmid for SpCas9-based CRISPR KO of mouse α-synDepositorInsertmouse a-synuclein sgRNA (Snca Mouse)
UseLentiviralAvailable sinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#1-puro
Plasmid#231981PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
sABE v3.22 Lenti_2
Plasmid#209556PurposepU6-SpCas9_sgRNA-pCMV-bpSV40_NLS-TadA-8e (2-76)-2xFRBDepositorInsertSpCas9 sgRNA, TadA-8e (2-76)-2xFRB
ExpressionMammalianPromoterpU6, pCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-2
Plasmid#109009PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A1NT
Plasmid#62255Purposeexpression of A1NT sgRNA from the arabinose-inducible promoterDepositorInsertA1NT
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only