We narrowed to 79,313 results for: Rest
-
Plasmid#45269DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pSW002-Pc-TorT(sp)-mNeonGreen
Plasmid#205021PurposeBroad host-range bacterial expression vector with constitutive Pc promoter. Provides E. coli TorT signal peptide in frame with mNeonGreen (codon optimized for expression in P. fluorescens); for targeting mNeonGreen to the periplasmDepositorInsertTorT-mNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPcAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP MPS1 K-R
Plasmid#59819PurposeAllows the integration of GFP MPS1 K-R in the genome and Tet-inducible expression.DepositorInsertMps1 (TTK Human)
TagsEmGFPExpressionMammalianMutationKD, catalytically inactive, D664APromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_GPR160
Plasmid#45274DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRP[2CRISPR]-mCherry/Hygro-hCas9-U6>{mdx left}-U6>{mdx right}
Plasmid#184381PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, two gRNAs targeting dystrophin
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
RCAS-sgATG7
Plasmid#75228PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor GammohDepositorAvailable SinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pWzl_neo_DEST_flag_SOX2
Plasmid#45309DepositorAvailable SinceMay 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCSP1-mp53AS-6xMUT
Plasmid#20904DepositorInsertp53AS (Trp53 Mouse)
ExpressionMammalianMutationpoint mutation (Ser/Thr-Ala) of the 6 N-terminal …Available SinceApril 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDD3248 pCS2-mtagBFP2-p2a-NES-arrb2a-(ENLYFQ/S)x3-SV40NLS-sfCherry3C(1-10)
Plasmid#251770PurposeBlue fluorescent protein-tagged TEVp substrate (three-peat motif) for fluorescent protein reconstitution assayDepositorInsertarrestin, beta 2a (arrb2a Zebrafish)
TagsNLS (SV40), sfCherry3C large fragment and mTagBFP…ExpressionMammalianPromoterCMV IE94Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MeCP2-R168X (pc4734 )
Plasmid#249081PurposeBacteria expression plasmid of MeCP2-R168X (aa1-aa167)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-MeCP2-R255X (pc4735)
Plasmid#249082PurposeBacteria expression plasmid of MeCP2-R255X (aa1-aa254)DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-GFP-MeCP2 (pc4741 )
Plasmid#249083PurposeBacteria expression plasmid of GFP-MeCP2DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
hTRAK1(S200A, S201A, S719A, S919A)
Plasmid#225225PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A, S719A, S919A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationS200A, S201A, S719A, S919A mutationsPromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
MYC-hTRAK1(S200A, S201A)
Plasmid#219572PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationSerine 200 changed to alanine, serine 201 changed…PromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#1/Cre
Plasmid#193244PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-TagBFP
Plasmid#183867PurposeRepair template for the C-terminal tagging of H2B histones with mTagBFP in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mTagBFP (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mTagBFPExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST*-GFP
Plasmid#163667PurposeExpresses partial length ST in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (first 113 amino acids) (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationThis chimera contains the first 113 amino acids o…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only