We narrowed to 25,285 results for: crispr
-
Plasmid#170301PurposeA knock-out vector for the mouse Ptgs2 in Balb/cDepositorInsertA gRNA targeting the mouse tyrosinase gene.
UseCRISPR and LentiviralAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable sinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable sinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL235 NheI-Cas9-KpnI-GSAlinker-FseI-TdT-NotI
Plasmid#126480PurposeExpresses Cas9-GSAlinker-TdT in mammalian cells.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsExpressionMammalianMutationChanged codons to reduce repetitive sequences.PromoterCMVAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAKanCRISPR
Plasmid#242231PurposeA sgRNA expression plasmid for genome editing in PseudomonasDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ACTB-C4
Plasmid#229849PurposeExpresses wild-type Cas9 and gRNA for ACTB gene. The target sequence is changed from ACTB-C1 to improve the cut efficiency.DepositorInsertguide RNA for ACTB gene
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-sgACSL3.C-Cas9-P2A-Puro
Plasmid#129412PurposeEncoding Cas9 and sgACSL3.C for CRISPR/Cas9 mediated HDR tagging of endogenous human ACSL3 C-terminusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 and sgACSL3.C (ACSL3 Human)
UseCRISPRTagsP2A-PuroExpressionMammalianPromoterhU6Available sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEffector-LaTranC-CRISPR RNA
Plasmid#246928Purposefor E.coli plasmid interference and PAM depletion assaysDepositorInsertLaTranC
UseUnspecifiedAvailable sinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/GFP-SCAF4 (CRISPR_resistant)
Plasmid#122471PurposeDox-inducible GFP (N-terminal tag) SCAF4 expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSCAF4 (SCAF4 Human)
TagsGFPExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable sinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFRT/TO/GFP-SCAF8 (CRISPR_resistant)
Plasmid#122472PurposeDox-inducible GFP (N-terminal tag) SCAF8 expressionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSCAF8 (SCAF8 Human)
TagsGFPExpressionMammalianMutationSynonymous mutations conferring resistance to gRN…PromoterCMVAvailable sinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR-SFFV-Puro-P2A-EGFP_peg
Plasmid#253729PurposeBackbone plasmid for cloning pegRNAsDepositorTypeEmpty backboneAvailable sinceJuly 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187948PurposeER50 degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertER50-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…Available sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC-ODN-hsRPL3-CterTwStrep-ΔPAM62&56
Plasmid#208645PurposeRemove PAM region in HomoArms by introduce SNP rs7495557 and rs760194863, to prevent cleavage after success edit. Digest with nt.BspQI and nb.BsrDI to get ssDNA.DepositorInsertTwin Strep tag with RPL3 genome HomoArm (RPL3 Human, Synthetic)
UseCRISPR; Ssdna donnor preparation for knock-in of…TagsTwin StrepMutationTwo SNP (rs749555789, rs760194863) were introduce…Available sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G3_Dual_sgRNA
Plasmid#173205PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable sinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
Px330-EGFP-LRRK2-CRISPR/Cas9
Plasmid#180437PurposePlasmid to express Cas9 from S.pyogenesand CRISPR gRNA to introduce LRRK2-G2019S mutation in human cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable sinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 FBXW7 sg1
Plasmid#258100PurposeKnockoutDepositorAvailable sinceJuly 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 FBXW7 sg2
Plasmid#258101PurposeKnockoutDepositorAvailable sinceJuly 13, 2026AvailabilityAcademic Institutions and Nonprofits only