We narrowed to 7,002 results for: tac
-
Plasmid#185766PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, SMAShMutationnonePromoterSFFVAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFFV-SMASH-NTERM-GFP
Plasmid#185761PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, SMAShMutationnonePromoterSFFVAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-roxSTOProx-tRFP-pA-lox
Plasmid#196888PurposeDre-activated Cre-inactivated expression of turbo (t)RFP reporter.DepositorInsertturbo (t)RFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_U6_sgRNA_Mettl3C
Plasmid#165420PurposesgRNA construct for targeting Mettl3 C-terminusDepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
SFFV-AID-NTERM-GFP
Plasmid#185763PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, AIDMutationnonePromoterSFFVAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
OMM-long-CFAST10
Plasmid#233598PurposeExpression of CFAST10 on the OMM membrane after a long linkerDepositorInsertCFAST10
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_eZ3_Gal4VP64
Plasmid#169917PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch3 core with an additional EGF repeat, and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianMutationAdditional EGF repeat between the extracellular d…PromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4 K41M-3xFLAG
Plasmid#69838PurposeThis plasmid encodes kinase dead PLK4 isoform 1 (K41M mutation) with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pK263.CAG-loxP-stop-loxP-NLSturboRFP-ires-tTA-WPRE
Plasmid#89587PurposeFor nucleus-specific turboRFP labeling in single cells, pK263 should be used with pK031.DepositorInsertnuclear localization signal (nls) turboRFP
ExpressionMammalianAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-IP3KB
Plasmid#32528DepositorAvailable SinceOct. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
SFFV-AID-CTERM-GFP
Plasmid#185768PurposeDegron-GFP fusion plasmid with restriction sites BamH1 and EcoR1 around GFP for subcloningDepositorInsertGFP
UseLentiviralTagsV5, AIDMutationnonePromoterSFFVAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-IRG1-L272Q-HA
Plasmid#198184PurposeMammalian expression of HA-tagged human ACOD1 (IRG1) L272QDepositorInsertACOD1 (ACOD1 Human)
TagsHAExpressionMammalianMutationThe leucine in IRG1 at position 272 mutates to gl…PromoterCMVAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2-CreLite
Plasmid#131783PurposeTol2 destination vector carrying Ubi:CreLite with mTagBFP2 as a visual marker.DepositorInsertPhyBCreC, PIF6CreN, and mTagBFP2
UseCre/Lox and Synthetic Biology; Zebrafish tol2 tra…TagsmTagBFP2ExpressionMammalianPromoterUbiAvailable SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pQCXIP GFP-MOSPD2 RD/LD
Plasmid#186468PurposeExpression of human MOSPD2 (mutant R404D/L406D, unable to bind FFAT motifs) fused to EGFP in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsEGFPExpressionMammalianMutationR404D/L406D (mutant unable to bind FFAT motifs)Available SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO/STRP 3x FLAG cyclin B1 L45A (1391)
Plasmid#61841Purposemammalian expression of cyclin B1 non-degradable L45A mutantDepositorInsertcyclin B1 (CCNB1 Human)
Tags2xSTREP and 3xFLAGExpressionMammalianMutationL45APromoterCMVAvailable SinceFeb. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
VPS13C^halo∆1235-1748
Plasmid#187297PurposeExpress VPS13C truncation mutant in mammalian cellsDepositorInsertVPS13C truncation mutant (VPS13C Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 A242V
Plasmid#11022DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only