We narrowed to 11,780 results for: 110
-
Plasmid#110804PurposeExpresses SaODH and opine dehydrogenase from Staphylococcus aureusDepositorAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pMINTC3H
Plasmid#110075PurposeAnalogous to pMINTNH3 but with a C-terminal 3C cleavage site and His10 tag.DepositorTypeEmpty backboneTags3C cleavage site - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNTK Gatad2a flox
Plasmid#110812PurposeDonor targeting vector for generating mouse Gatad2a conditional knockout alleleDepositorInsertmGataD2a (Gatad2a Mouse)
UseUnspecifiedAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CCDC32
Plasmid#110505PurposeFluorescent CCDC32DepositorAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CCDC32
Plasmid#110506PurposeFluorescent CCDC32DepositorAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW12
Plasmid#110224Purposeintegration of ura4+-loxM3 cassetteDepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TRE3G-BE3-PGK-Puro
Plasmid#110845PurposeLentiviral vector for dox-inducible expression of BE3 (not codon optimized)DepositorInsertBE3
UseLentiviralMutationD10APromoterTRE3GAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMINTC3GH (Hyg)
Plasmid#110077PurposeAnalogous to pMINTNH3 but with a C-terminal 3C cleavage site and a GFP-His10 tag fusion.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEXC3GH (Hyg)
Plasmid#110082PurposeAnalogous to pMINTC3GH but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBb(B5)8k-sfGFP
Plasmid#110140PurposeIPTG-inducible pTRC promoter expressing sfGFP on BBR1-B5 originDepositorInsertsfGFP
ExpressionBacterialAvailable SinceJuly 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_PCNA_PCNA
Plasmid#110022PurposeProtein expression and purification of PCNA_PCNADepositorInsertPCNA_PCNA (PCNA Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Human USP30 (64-502, construct 13, MG-26-82)
Plasmid#110746PurposeBacterial expression of human USP30 (construct 13)DepositorInsertUSP30 (USP30 Human)
TagsN-His6-3C-GST-3CExpressionBacterialMutationF348D, M350S, I353E + insertion deletion: 64-178;…PromoterT7Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKOdeltagalK (Kan)
Plasmid#110089PurposeAnalogous to pKO but without the negative selection gene galK.DepositorTypeEmpty backboneUseBacterial knockout generationAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJM60-FLAG NUFIP1
Plasmid#110950Purposeexpresses mammalian FLAG-NUFIP1DepositorAvailable SinceNov. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMINTNH3
Plasmid#110074PurposeIntegrative vector for expression in mycobacteria based on the Tet promoter. Contains an N-terminal His10 Tag followed by a 3C cleavage siteDepositorTypeEmpty backboneTagsHis10 Tag - 3C cleavage siteExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGAC
Plasmid#110423PurposeshGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selectionDepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEXC3GH (Kan)
Plasmid#110081PurposeAnalogous to pMINTC3GH but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO/Flag-tGFP-HuR.wt
Plasmid#110376PurposeMammalian expression of turboGFP-HuR (wild type) with FLAG tag, Flp-In T-Rex systemDepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
TagsFLAG and tGFPExpressionMammalianPromoterCMVAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p175 Grg-1s HA
Plasmid#11064DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only