We narrowed to 5,488 results for: mag
-
Plasmid#72036PurposeExpresses the extracellular region of the Sema5B protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Sema5b-Fc-His
Plasmid#72162PurposeExpresses the extracellular region of the Sema5B protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZ_P-GAP-LacI-Mit1AD
Plasmid#126722PurposeLacI-Mit1AD on pGAPZ_ A expression vectorDepositorInserthybrid lacI-Mit1 activation domain coding sequence
ExpressionYeastPromoterGAPAvailable sinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-Nterm 6xHis PL-T500
Plasmid#92314PurposeExpression of NTerm 6xHis tagged protein L (PL) domain using the p70a promoter and UTR1DepositorInsertB1 domain of protein L (PL)
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70aAvailable sinceOct. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCaggs-mGold2t
Plasmid#231764PurposeExpression of mGold2t in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmGold2t
ExpressionMammalianMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterActin promoter with CMV enhancerAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin I affinity mutant (F40-based tension sensor)
Plasmid#119190PurposeThe affinity mutant for the F40-based human desmoplakin I tension sensor incorporates a point mutation that exhibits enhanced keratin association.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman Desmoplakin I(S2849G)-[mTFP1-F40-mEYFP] (internal-1945) (DSP Human)
UseTransposonTagsmTFP1-F40-mEYFPExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterTCEAvailable sinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-jYCaMP1s (AAV1)
Viral prep#135420-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-FLEX-jYCaMP1s (#135420). In addition to the viral particles, you will also receive purified pAAV-syn-FLEX-jYCaMP1s plasmid DNA. Synapsin-driven, Cre-dependent expression of calcium sensor YCaMP1s. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDS1904
Plasmid#175596PurposeIntegrative vector for Candida albicans with dominant SAT1 markerDepositorTypeEmpty backboneAvailable sinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-Soma-jGCaMP8s (AAV Retrograde)
Viral prep#169256-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-hSyn-Soma-jGCaMP8s (#169256). In addition to the viral particles, you will also receive purified AAV-hSyn-Soma-jGCaMP8s plasmid DNA. hSyn-driven expression of soma-targeted calcium sensor GCaMP8s (more sensitive). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQLinkHD_mTFP1
Plasmid#118858Purposefluorescent protein expression with an N-terminal His-tagDepositorInsertmTFP1
TagsHis-tagExpressionBacterialAvailable sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFT3.2
Plasmid#208806PurposeExpresses the fluorescent protein iLOVDepositorInsertiLOV
ExpressionBacterialPromotertacAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
fabp10a:GCaMP6s; cryaa:mCherry
Plasmid#230060PurposeExpression of genetically encoded calcium indicator in zebrafish hepatocytes.DepositorInsertGCaMP6s
UseZebrafish expressionPromoterfabp10aAvailable sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJR2953
Plasmid#122549PurposeExpression of a C. elegan codon optimized florescent protein (CemCardinal2) under the intestinal specific promoter nhx-2DepositorInsertPnhx-2_CemCardinal2
ExpressionBacterialPromoterPnhx-2Available sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV200
Plasmid#110719PurposeLentiviral system for reduced ectopic expression.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable sinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV.CAG-FLEX.iGABASnFR.F102Y.Y137L
Plasmid#112168PurposeGABA SensorDepositorInsertiGABASnFR.F102Y.Y137L
UseAAVMutationF102Y.Y137LPromoterCAGAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJL31
Plasmid#227428PurposeKanamycin resistant L5-integrative vector for CRISPR interference in M.smegmatis with constitutive expression of mWasabi under the control of the psmyc promotor (psmyc::mWasabi)DepositorInsertmWasabi
UseCRISPRExpressionBacterialAvailable sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL32
Plasmid#227429PurposeKanamycin resistant L5-integrative vector for CRISPR interference in M.smegmatis with the constitutive expression of tdTomato under the control of the psmyc promotor (psmyc::tdTomato)DepositorInserttdTomato
UseCRISPRExpressionBacterialAvailable sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSRW1JZ
Plasmid#129528PurposeC. elegans codon-optimized FlincG3 (GFP-based cGMP sensor) expressed in C. elegans ASE neuron pairDepositorInsertFlincG3
ExpressionWormAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQLinkHD_EBFP2
Plasmid#118853Purposefluorescent protein expression with an N-terminal His-tagDepositorInsertEBFP2
TagsHis-tagExpressionBacterialMutationEBFP1.2-I128V/V150I/ D155V/V224RAvailable sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only