We narrowed to 4,205 results for: SUP
-
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tnnt2-Cre-U6-Lmna-sgRNA
Plasmid#206178PurposeExpresses Cre recombinase specifically in cardiomyocytes and uses U6 promoter to express sgRNAs targeting murine Lmna exon 10DepositorInsertCre
UseAAVPromotercTnTAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A-GS3
Plasmid#204753PurposeExpression of Cas9 and human H2ADepositorInsertH2A (H2AC20 Human)
ExpressionMammalianAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRMTK-clo39
Plasmid#204014PurposeCloning plasmid containing the sfGFP insert with a chloramphenicol resistance markerDepositorInsertsuper folder green fluorescent protein
ExpressionPlantPromoterN/AAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TYMS_sgRNA2
Plasmid#201629PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTYMS (TYMS Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hSOX2AV
Plasmid#193352PurposeRetroviral vector expressing human SOX2A61V point mutantDepositorInsertSOX2AV (SOX2 Human)
UseRetroviralExpressionMammalianMutationSOX2A61V is a highly cooperative point mutant of …Promoter5'LTRAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
ABHD2-3'UTR-WT
Plasmid#190094Purposeexamine the activity of ABHD2 3'UTRDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTet2#2/Cre
Plasmid#173656PurposeExpresses a Tet2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tet2 (Tet2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgDot1l#1/Cre
Plasmid#173589PurposeExpresses a Dot1l-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Dot1l (Dot1l Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTet2#1/Cre
Plasmid#173655PurposeExpresses a Tet2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tet2 (Tet2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgDot1l#2/Cre
Plasmid#173590PurposeExpresses a Dot1l-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Dot1l (Dot1l Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-anti-MIR328-3p
Plasmid#153319PurposeExpresses zsGreen fused to a miR-328-3p sponge and mCherry in mammalian cells.DepositorInsertzsGreen with MIR328-3p sponge
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-anti-MIR211-5p
Plasmid#153318PurposeExpresses zsGreen fused to a miR-211-5p sponge and mCherry in mammalian cells.DepositorInsertzsGreen with MIR211-5p sponge
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZmat3.52.6/Cre
Plasmid#167854PurposeExpresses Cre recombinase and an sgRNA targeting Zmat3DepositorInsertsgRNA targeting Zmat3
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgMARK4-A
Plasmid#138676PurposeExpresses a mouse MARK4-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgMARK4-B
Plasmid#138677PurposeExpresses a mouse MARK4-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti4 Blast RFP-PNRC1
Plasmid#123297PurposeMammalian expression of PNRC1 N-RFPDepositorAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only