We narrowed to 44,227 results for: gats
-
Plasmid#162786PurposeThe extracellular domain of Angiotensin converting enzyme 2 (ACE2) expressionDepositorInsertAngiotensin-converting enzyme 2 (ACE2 Human)
Tags10xHis, FLAG, and hTPA leaderExpressionMammalianPromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AviTag-His6-OAZ-SPM(FrpA)-Ctag
Plasmid#246646PurposeExpresses AviTag-His6-OAZ-SPM(FrpA)-Ctag in bacterial cells for calcium-induced NeissLock protein ligationDepositorInsertAviTag-His6-OAZ-SPM(FrpA)-Ctag
TagsAviTag, Ctag, and His-tagExpressionBacterialMutationResidues 95-219 of human Orinithine Decarboxylase…PromoterT7Available SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
p5E-hs_UbiC-pro (JDW 1461)
Plasmid#242547PurposeEnhancer/Promoter: Gateway 5' entry vector containing human Ubc promoter (-1225 to -6)DepositorInsertUbiquitin / Ubc promoter (UBC Human)
UseGateway subcloningAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-ITGB1(no stop)
Plasmid#215453PurposeGateway entry vector with integrin beta1 wild-type (WT) without a stop codonDepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceSept. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
p5E-Crestin-pro (JDW 1320)
Plasmid#229830PurposeA gateway compatible 5' entry clone containing the crestin gene followed by the mus musculus c Fos minimal promoter and then a rabbit beta globin intron to drive neural crest-specific gene expressionDepositorInsertCrestin promoter, c-fos minimal promoter, and b-globin intron
UseGateway entry cloneAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-TDP-43
Plasmid#162608PurposeAllows for transcription of TDP-43 mRNA for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 LC3B Q116P G120
Plasmid#129291PurposeGateway entry clone encoding human deconjugation-resistant LC3BDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
UseGateway entry vector / entry cloneMutationChanged Glutamine 116 to Proline. Deleted amino a…Available SinceNov. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR201-JIP60ml
Plasmid#104959PurposeEncodes a modified, active, form of Hordeum vulgare c.v. Golden Promise Jasmonate Induced Protein 60 (JIP60)DepositorInsertJasmonate Induced Protein 60 (JIP60)
UseGateway entry vector for lr recombination into ot…MutationReplaced amino acids 164 to 187 with a methionine…Available SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tet-off TauRD (P301L/V337M)
Plasmid#188572PurposeDox-repressible expression of the Tau repeat domainDepositorInsertTau repeat domain (MAPT Human)
UseLentiviralTagsMycExpressionMammalianMutationP301L and V337MPromoterpTight TREAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
TagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-TDP-43 M337V
Plasmid#162609PurposeAllows for transcription of mutant TDP-43-M337V mRNA for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC35A2_STOP
Plasmid#161313PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC35A2 (SLC35A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43 M337V
Plasmid#162618PurposeAllows for transcription of mCerulean fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43
Plasmid#162617PurposeAllows for transcription of mCerulean fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-I152L-GGGS-TDP-43
Plasmid#162614PurposeAllows for transcription of improved mVenus I152L fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-GGGS-TDP43 M337V
Plasmid#162612PurposeAllows for transcription of mVenus fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENT-L1-Kozak-EGFP-GPI-stop-L2
Plasmid#186355PurposeEntry clone with ORF encoding plasma membrane-targeted EGFP-GPI fusion protein flanked by Gateway recombination sequencesDepositorInsertsignal peptide of human CD59, eGFP, aa 67-102 of human CD59 which contains the GPI attachment site (CD59 Synthetic, Human)
UseExpression of a fluorescent membrane markerTagsEGFPAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC32A1
Plasmid#132112PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC32A1 (SLC32A1 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits