We narrowed to 4,748 results for: NAP
-
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 NSP4_nostop
Plasmid#149307PurposeGateway-compatible Entry vector, with insert of NSP4 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertNSP4 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 NSP8_nostop
Plasmid#149311PurposeGateway-compatible Entry vector, with insert of NSP8 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1. Does not contain stop codon.DepositorInsertNSP8 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceMay 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-DIO {hCAR}off-{ChETA-EYFP}on-W3SL
Plasmid#111392PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON ChETA-EYFP (for optogenetic activation), and W3SL regulatory cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsEYFP and MycExpressionMammalianMutationPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 Luciferase
Plasmid#117072Purposesingle guide RNA targeting LuciferaseDepositorInsertLuciferase
UseCRISPRTagsExpressionMutationPromoterhU6Available SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5LdeltaER-SBP-mCitrine
Plasmid#154846PurposeSynchronize trafficking of Stx5LdeltaER (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Long isoform) (STX5 Human)
UseTagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
PET.SUMO eIF4G1 +MIC 1-200
Plasmid#158792PurposeBacterial expression vector for the expression of N-terminal 6xHIS-SUMO-tagged codon optimized eIF4G1 amino acids 1-200 isoform including the microexon.DepositorInserteIF4G1 (with microexon) codon optimized
UseTags6xHIS and SUMOExpressionBacterialMutationamino acids 1-200PromoterT7Available SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 S 24nt-del
Plasmid#153952PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 23, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 S 24nt-del_nostop
Plasmid#153953PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 rtTA BirA eIF4G
Plasmid#158789PurposepcDNA5 based transfection plasmid for the exogenous expression of N-terminal BirA-Flag-tagged eIF4G1 lacking the microexon for generation of N2A FlpIn cell lines for BioIDDepositorInserteIF4G1
UseTags3xFlag and BirA*ExpressionMammalianMutationPromoterminiCMVAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 ORF7B C-trunc_nostop
Plasmid#153956PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 11, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 ORF7B C-trunc
Plasmid#153957PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorTagsExpressionMutationMany synonymous changes due to codon optimizationPromoterAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2
Plasmid#240865PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianMutationPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
Plasmid#240094PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianMutationPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVDnmt3AL_bGHpA
Plasmid#177348PurposeAAV expression of a fusion protein with scFV, catalytic domain of Dnmt3a and C terminal domain of Dnmt3l from Synapisin promoter for targeted DNA methylation editingDepositorInsertcatalytic domain of DNA Methyltransferase 3 Alpha (Dnmt3a Mouse)
UseAAVTagsC-terminal domain of mouse Dnmt3l (194–415 aa), P…ExpressionMammalianMutation598–908 aa of mouse Dnmt3aPromoterhuman SynapsineAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-2-seed
Plasmid#184535PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-1
Plasmid#184536PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
shTRIP13-2
Plasmid#184537PurposeshRNA expression vectorDepositorAvailable SinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only