We narrowed to 9,373 results for: Pol;
-
Plasmid#177143PurposeLentiviral vector expressing Flag-PolB(T304I) and a puromycin resistance cassetteDepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pGEX4T3-GST-PolB(K206A/K244A)
Plasmid#177135PurposeBacterial vector for expression of an N-terminal GST fusion of PolB(K206A/K244A) with a TEV protease site located between the GST tag and PolB(K206A/K244A)DepositorInsertPolB
TagsGSTExpressionBacterialPromoterTacAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
C453-E18: attB4-polyhedrinp>-attB5
Plasmid#162977PurposeGateway attB4/attB5 entry clone for baculovirus expression using the AcMNPV polyhedrin promoterDepositorInsertAcMNPV polyhedrin promoter
UseSynthetic BiologyAvailable SinceAug. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
C238-E07: attB2r-SV40polyA-attB3
Plasmid#162917PurposeGateway attB2r/attB3 entry clone containing a polyA sequence for transcription terminationDepositorInsertSV40 polyadenylation sequence
UseSynthetic BiologyAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
C453-E25: attB4-mPol2p>-attB5
Plasmid#162981PurposeGateway attB4/attB5 entry clone for mammalian expression using the murine RNA polymerase 2 promoterDepositorInsertmurine RNA polymerase 2 promoter
UseSynthetic BiologyAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCT-CMV-copGFP-Polß(WT)-puro
Plasmid#128665Purposemammalian expression of copGFP-Polß(WT) protein with puromycin selectionDepositorInsertPolB (POLB Human)
UseLentiviralTagscopGFPExpressionMammalianMutationWild typePromoterCMVAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-Polß(TM)-IRES-hyg
Plasmid#128668Purposemammalian expression of Flag-Polß(TM: L301R/V303R/V306R) protein with hygromycin selectionDepositorInsertPolB (POLB Human)
UseLentiviralTagsFlagExpressionMammalianMutationL301R/V303R/V306RPromoterCMVAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
C513-E06: attB5r-pA-polyhedrinp>-attB1r
Plasmid#162948PurposeGateway attB5r/attB1r entry clone containing an AcMNPV polyhedrin promoter with upstream polyA, for use in construction of polycistronic baculovirus expression vectorsDepositorInsertAcMNPV polyhedrin promoter with upstream polyA sequence
UseSynthetic BiologyAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
C413-E19: attB4-mPol2p>-attB1r
Plasmid#162971PurposeGateway attB4/attB1r entry clone for mammalian expression using the human EF1alpha promoterDepositorInsertmurine RNA polymerase 2 promoter
UseSynthetic BiologyAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-Polß(TM)-IRES-neo
Plasmid#128671Purposemammalian expression of Flag-Polß(TM: L301R/V303R/V306R) protein with neomycin selectionDepositorInsertPolB (POLB Human)
UseLentiviralTagsFlagExpressionMammalianMutationL301R/V303R/V306RPromoterCMVAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLA1 ISCmut
Plasmid#160808PurposeExpress ISC mutant POLA1DepositorInsertPOLA1 ISCmut (POLA1 Human)
UseRetroviralMutationCodon optimized, C1354S, C1359S, C1377S, C1380SAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-3_PolyU(1)_Tornado-Corn
Plasmid#159503PurposeTests for the impact of 1 uracil in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-3_PolyU(1)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(7)_Tornado-Corn
Plasmid#159493PurposeTests for the impact of 7 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(7)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(4)_Tornado-Corn
Plasmid#159490PurposeTests for the impact of 4 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(4)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-2_PolyU(2)_Tornado-Corn
Plasmid#159488PurposeTests for the impact of 2 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-2_PolyU(2)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(4)_Tornado-Corn
Plasmid#159482PurposeTests for the impact of 4 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(4)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(5)_Tornado-Corn
Plasmid#159483PurposeTests for the impact of 5 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(5)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(6)_Tornado-Corn
Plasmid#159484PurposeTests for the impact of 6 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(6)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(7)_Tornado-Corn
Plasmid#159485PurposeTests for the impact of 7 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(7)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Linear-1_PolyU(8)_Tornado-Corn
Plasmid#159486PurposeTests for the impact of 8 uracils in a poly-uracil tract on human polymerase III transcription from a U6 promoter.DepositorInsertTermination Module:Linear-1_PolyU(8)
ExpressionMammalianPromoterU6-27Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
KZ101: pMVP (L3-L2) P2A-eCFP + polyA
Plasmid#121768PurposepMVP L3-L2 entry plasmid, contains eCFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eCFP linked by P2A to gene of interest.DepositorInsertP2A-eCFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ301: pMVP (L3-L2) P2A-Blast + polyA
Plasmid#121779PurposepMVP L3-L2 entry plasmid, contains Blast-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Blast selection marker linked by P2A to gene of interest.DepositorInsertP2A-Blast + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ201: pMVP (L3-L2) P2A-Hygro + polyA
Plasmid#121782PurposepMVP L3-L2 entry plasmid, contains Hygro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Hygro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Hygro + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG901: pMVP (L3-L2) HA epitope tag + polyA
Plasmid#121749PurposepMVP L3-L2 entry plasmid, contains HA epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertHA epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
YIp128-P30-His-pol30(K127R)
Plasmid#99543PurposeYeast integrative vector for expression of His-tagged POL30 (PCNA) mutant K127R; Leu2 markerDepositorAvailable SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
attB-GFP-Dnmt3b6-Poly(A)-NeoR
Plasmid#65552PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b6 cDNA into a MIN-tagged locus using Neomycin selectionDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 6Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-CasRX-P2A-EGFP-BGH PolyA
Plasmid#154004PurposeExpress CasRxDepositorInsertCasRx
UseCRISPRPromoterCAGAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGP-CAG-iGABASnFR2-WPRE-bGH-polyA
Plasmid#218868PurposeMammalian expression of improved GABA sensor (positive change in fluorescence)DepositorInsertiGABASnFR2
ExpressionMammalianMutationS99A F102Y F104Y L178SPromoterCAGAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1(Hygro) myc-hPolQ-Flag
Plasmid#73132PurposeTo express in mammalian cells human PolQDepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only