Skip to main content

We narrowed to 9,897 results for: Tet-on

Showing: 341 - 360 of 9897 results
  1. tet-pLKO.puro_shHuR 3UTR

    Plasmid
    #110412
    Purpose
    TRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selection
    Insert
    ELAVL1 (HuR)
    Use
    Lentiviral and RNAi
    Expression
    Mammalian
    Promoter
    H1/TO (RNA PolIII)
    Available Since
    Feb. 23, 2021
    Availability
    Academic Institutions and Nonprofits only
  2. pTC-CMV-Tet

    Plasmid
    #85577
    Purpose
    Sleeping beauty transposon for hydrodynamic tail vein injection for CreER expression and tetracyclin-dependent transgene/shRNA expression (CMV promoter) in mouse liver
    Depositor
    Insert
    CreER
    Use
    Cre/Lox
    Expression
    Mammalian
    Promoter
    ApoE.HCR.hAAT
    Available Since
    Jan. 9, 2017
    Availability
    Academic Institutions and Nonprofits only
  3. pFRT-Tet 129

    Plasmid
    #33359
    Depositor
    Insert
    TetR cassette
    Use
    Mouse Targeting
    Tags
    FRT site
    Available Since
    Jan. 11, 2012
    Availability
    Academic Institutions and Nonprofits only
  4. pCIBN-TetR-tagRFP-T

    Plasmid
    #103809
    Purpose
    'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitment
    Depositor
    Insert
    CIBN-TetR-tagRFP-T (CIB1, tetR E. coli, Mustard Weed)
    Expression
    Mammalian
    Mutation
    TetR: A4G (M2V)
    Promoter
    CMV
    Available Since
    Jan. 9, 2018
    Availability
    Academic Institutions and Nonprofits only
Showing: 341 - 360 of 9897 results