We narrowed to 7,856 results for: gast
-
-
-
-
-
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT1AR gRNA (5-HT1A Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA2 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT7R gRNA (5-HT7 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available sinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf nhsl1b-mNeongreen
Plasmid#233883PurposemNeongreen tagged form of zebrafish nhsl1b. For in vitro transcription (SP6) or expression through CMV.DepositorInsertnhsl1b (nhsl1b Zebrafish)
UseIn vitro synthesis of mrnaTagsmNeongreenExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_spatzle-HA
Plasmid#240227PurposeGateway entry clone with spatzle tagged with HA (contains stop codon)DepositorInsertspatzle (spz Fly)
UseGateway shuttle vectorTagsHA-spGFP11ExpressionMutationPromoterAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-EGFP-Vasa 463-661 MUT (F504E) (HK196)
Plasmid#206434PurposeVasa 463-661 expression in Schneider cells for imagingDepositorInsertVasa 463-661 (vas Fly)
UseTagsEGFPExpressionInsectMutationF504EPromoterAvailable sinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mCherry-Oskar 139-240 MUT (A162E/L228E) (HK202)
Plasmid#206464PurposeOskar 139-240 mut expression in Schneider cells for imagingDepositorInsertOskar 139-240 mut (osk Fly)
UseTagsPH mcherryExpressionInsectMutationA162E L228E)PromoterAvailable sinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
Plasmid#217509PurposeKD Recombinase dependent conditional 1X ALFA cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-1XALFA
UseTagsALFA tagExpressionInsectMutationPromoterAvailable sinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS1983 Lenti-dead_GFP_ABE reporter-BlastR
Plasmid#211820PurposeLentiviral vector expressing a dead GFP adenine base editing reporterDepositorInsertdead GFP reporter
UseLentiviralTagsExpressionMammalianMutationPromoterCMV promoter and SV40 promoterAvailable sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVTagsExpressionMammalianMutationPromoterU6Available sinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS7 puro
Plasmid#208405PurposeExpresses FLAG-tagged Drosophila IntS7 from inducible MtnA promoterDepositorInsertpMT FLAG MCS puro (defl Fly)
UseTags3xFLAGExpressionInsectMutationPromoterMtnAAvailable sinceDec. 8, 2023AvailabilityAcademic Institutions and Nonprofits only