We narrowed to 7,180 results for: cas9 plasmid
-
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAGM55361
Plasmid#153227PurposeControl plasmid for knockout of AP3 geneDepositorInsertCas9, guide RNA for TRY and CPC and FAST marker
UseSynthetic BiologyAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEG302 5aa SunTag VP64 g4+g17 (FWA)
Plasmid#119672PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with two guide RNAsDepositorInsertg17_U6_g4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX300A-G+Nanog
Plasmid#140280PurposeCRISPR/Cas9 plasmid encoding Cas9 and sgRNA against gBait and Nanog locusDepositorInsertCas9
ExpressionMammalianPromoterCBHAvailable SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpRY-His
Plasmid#179320PurposePlasmid for bacterial expression and purification of SpRY-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpRY
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpG-His
Plasmid#179318PurposePlasmid for bacterial expression and purification of SpG-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpG
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only