We narrowed to 15,706 results for: ski
-
Plasmid#115851PurposeAGO1 knockdownDepositorAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pLEX-FHH-NRASQ61K/T35A-IRES-Puro
Plasmid#120571PurposeExpresses Flag-HA-6xHIS-N-Ras Q61K/T35A fusion protein in mammalian cells & for virus productionDepositorInsertNRAS (NRAS Human)
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationQ61K, T35APromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-FHH-NRASQ61K/Y40A-IRES-Puro
Plasmid#120573PurposeExpresses Flag-HA-6xHIS-N-Ras Q61K/Y40A fusion protein in mammalian cells & for virus productionDepositorInsertNRAS (NRAS Human)
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationQ61K, Y40APromoterCMVAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-FHH-NRASQ61K/E37A-IRES-Puro
Plasmid#120572PurposeExpresses Flag-HA-6xHIS-N-Ras Q61K/E37A fusion protein in mammalian cells & for virus productionDepositorInsertNRAS (NRAS Human)
UseLentiviralTagsFlag-HA-6xHISExpressionMammalianMutationQ61K, E37APromoterCMVAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-AGO2 ts3
Plasmid#115855PurposeAGO2 knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-3
Plasmid#112843Purposetransient/stable overexpression of the C-terminal domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)/Puro/FA/GFP-C--Catulin-1
Plasmid#112841Purposetransient/stable overexpression of the N-terminal domain of Catulin.DepositorAvailable SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSET iGluSnFR3 v857
Plasmid#175186PurposeFluorescent reporter for glutamate, third generation, variant 857 soluble form to express in bacteria.DepositorInsertiGluSnFR3 v857
UseSynthetic BiologyTagsHis tag, T7 leader, Xpress epitopeExpressionBacterialPromoterT7Available SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pscALPSblasti-TMPRSS2 Blasti
Plasmid#158088PurposeExpresses TMPRSS2 in mammalian cellsDepositorAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRSET iGluSnFR3 v82
Plasmid#175187PurposeFluorescent reporter for glutamate, third generation, variant 82 soluble form to express in bacteria.DepositorInsertiGluSnFR3 v82
UseSynthetic BiologyTagsHis tag, T7 leader, Xpress epitopeExpressionBacterialPromoterT7Available SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bidirectional MYC 5'UTR Dual Fluorescence Reporter
Plasmid#229498PurposeThis is a lentiviral reporter for translation initiation under the control of the Myc 5'UTR, which produces destabilized GFP (dsGFP). There is a control destabilized mCherry (dsmCherry) as a control.DepositorInsertMYC 5'Untranslated region + destabilized GFP
UseLentiviralExpressionMammalianPromoterEf1aAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-SOX2-T2A-2xNLS-tdTomato-F2A-Puro
Plasmid#89991PurposeDonor template for generation of SOX2-ntdTomato reporter cell linesDepositorAvailable SinceJune 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hACE2-hygro
Plasmid#161758PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable SinceNov. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.1 SARS-CoV-2 S D614G
Plasmid#158075PurposeExpresses SARS-CoV-2 spike protein with a D614G mutationDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP313-pAAV-CMV-SaCas9-DIO-pA
Plasmid#113690PurposeA CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-HA-birA*-K-Ras(wildtype)-IRES-Puro
Plasmid#120561PurposeExpresses HA-birA*-K-Ras wildtype fusion protein in mammalian cells & for virus productionDepositorAvailable SinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-uORF-HA-birA*-H-Ras(wildtype)-IRES-Puro
Plasmid#120559PurposeExpresses HA-birA*-H-Ras wildtype fusion protein in mammalian cells & for virus productionDepositorAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP309-pAAV-EFS-dSaCas9-KRAB-Dio-pA
Plasmid#113686PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription repressor KRAB. dSaCas9-KRAB is floxed to render the system cre-dependent.DepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Cre/LoxTagsKRABAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82705PurposeAAV backbone with a full length U6/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertU6/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only