We narrowed to 12,348 results for: SHA;
-
Plasmid#195503PurposeSOX17 donor plasmid to generate locus specific C-terminal integration of H2B-mCitrine into the human SOX17-locusDepositorInsertSOX17(Ex2)-T2A-H2B-mCitrine_loxP-hPGK-BSD-loxP_SOX17(3'UTR) (SOX17 Human)
UseCRISPR; Donor vectorTagsT2A-H2B-mCitrineExpressionMammalianAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-RfxCas13d-NLS-HA
Plasmid#141321PurposePlasmid to carry out IVT of RfxCas13d-NLS (human codon-optimized)DepositorInsertRfx-Cas13d (NLS-RfxCas13d-NLS)
UseCRISPRTagsHA and NLSAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-MKK6-EE p38alpha
Plasmid#82719PurposeExpresses constitutively active human MKK6 and murine p38 alpha.DepositorExpressionBacterialMutationSer207 to Glu, Thr211 to GluAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK8-W105M-IRES-mCherry
Plasmid#68857PurposeExpresses Human CDK8 W105M MutantDepositorInsertCyclin-Dependent Kinase 8 (CDK8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationW105MPromoterEF1αAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLEVI(408)-ColE-iLight-msfGFP
Plasmid#170268PurposeExpresses LexA_DBD-iLight-msfGFP under J23116 promoter and mCherry under ColE promoter with a LexA408 operator in bacteria.DepositorInsertiLight
TagsmsfGFPExpressionBacterialMutationTo design iLight for expression in bacteria, a fu…PromoterpJ23116Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorTags13xMyc, Flag, and HAExpressionMammalianPromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC19_mRuby-3xFLAG-NLS-3xSV40-poly(A)_loxP-PGK-Puro-loxP
Plasmid#195505PurposeT-REX17 donor plasmid to generate locus specific integration of mRuby followed by 3xSV40 poly(A) into Exon 1 of human lncRNA T-REX17DepositorInsertpT-REX-mRuby-3xFLAG-NLS-3xSV40-poly(A)_loxP-PGK-Puro-loxP_T-REX(Ex1)
UseCRISPR; Donor vectorTagsmRuby-3xFLAG-NLS-3xSV40-poly(A)ExpressionMammalianAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
18065-M03-412
Plasmid#225666PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Flag-CDK19-W105M-IRES-ZsGreen
Plasmid#68859PurposeExpresses Human CDK19 W105M MutantDepositorInsertCyclin-Dependent Kinase 19 (CDK19 Human)
UseLentiviralTagsFlagExpressionMammalianMutationW105MPromoterEF1αAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UC-Cas9-T2A-mCherry
Plasmid#135014PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to C-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the C-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
Plasmid#135013PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Fyn-SH2-AviTag
Plasmid#214202PurposeBacterial expression of SH2 domain of the Fyn kinase (B- iso) with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Fgr-SH2-AviTag
Plasmid#214205PurposeBacterial expression of SH2 domain of the Fgr kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertFgr kinase SH2 domain (FGR Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg4_pX458
Plasmid#127339PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #4DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg3_pX330
Plasmid#127340PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA (Cdk13 Mouse)
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Untagged
Plasmid#127342PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2R)-NE
Plasmid#215487PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to arginine) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to RPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-hSNCA(D2E)-NE
Plasmid#215488PurposeLentiviral expression of mutated alpha-synuclein (2nd amino acid aspartate mutated to glutamate) in mammalian cellsDepositorInsertalpha-synuclein (SNCA Human)
UseLentiviralTagsNE tagExpressionMammalianMutationD (second aa) mutated to EPromoterUbcAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only