We narrowed to 6,278 results for: tTA
-
Plasmid#112024PurposeDNA sequence source for amplifying an HDR template to replace endogenous human TCR-beta with 1G4 NYESO TCR-betaDepositorInsertNYESO beta into TRBC1 HDRT
UseCRISPR and Synthetic BiologyAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28 E2 LBD-Tev-E1a-His
Plasmid#232117PurposeFor bacterial expression of a fusion protein containing from N to C-terminus: the lipoyl-binding domain of Human E2, a TEV protease site, a peptide from Human E1a, and a His tag.DepositorInsertDBT (DBT Human)
Tags6xHis, RIGHHSTSDDSSAY (AA331 to 345 (preprocessin…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
BIC-Gag-DDX3
Plasmid#233687PurposeExpresses a fusion between the Murine Leukemia Virus Gag polyprotein and the human DDX3 protein to produce virus-like particles loaded with DDX3 and deliver it to target cells.DepositorInsertDEAD-box helicase 3 (DDX3X Human)
UseRetroviralTagsGag (Murine Leukemia Virus)ExpressionMammalianPromoterhCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
t1-405(151-154AAAA)
Plasmid#166131PurposeExpression of human talin-1 head (aa1-405) in E. coli. Four substitutions in the F1-loop (aa151-154 all mutated to Al). N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(151-154AAAA) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405 only. Contains 4 amino acid substitutions…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SARS2SΔC-H2gp41
Plasmid#170389PurposeGeneration of SARS-CoV-2 spike pseudotyped lentivirusDepositorInsertSARS-CoV-2 Spike (S SARS-CoV-2)
TagsHIV gp41ExpressionMammalianMutationDeletion of C terminal and fusion with H2 from HI…PromoterCMVAvailable SinceJune 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
RAB11A-GFP HDRT Source (pTR 143)
Plasmid#112012PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with GFPDepositorInsertRAB11A-GFP HDRT (RAB11A Human)
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
RAB11A-mCherry HDRT Source (pTR 144)
Plasmid#112013PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with mCherryDepositorInsertRAB11A-mCherry HDRT (RAB11A Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD4-C-GFP HDRT Source (pTR 152)
Plasmid#112018PurposeDNA sequence source for amplifying an HDR template to tag endogenous human CD4 gene with GFPDepositorInsertCD4-GFP HDRT (CD4 Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
CLTA-GFP HDRT Source (pTR 153)
Plasmid#112016PurposeDNA sequence source for amplifying an HDR template to tag endogenous human CLTA gene with GFPDepositorInsertCLTA-GFP HDRT (CLTA Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
CLTA-mCherry HDRT Source (pTR 177)
Plasmid#112017PurposeDNA sequence source for amplifying an HDR template to tag endogenous human CLTA gene with mCherryDepositorInsertCLTA-mCherry HDRT (CLTA Human)
UseCRISPR and Synthetic BiologyAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
BATF-GFP HDRT Source (pTR 146)
Plasmid#112015PurposeDNA sequence source for amplifying an HDR template to tag endogenous human BATF gene with GFPDepositorInsertBATF-GFP HDRT (BATF Human)
UseCRISPR and Synthetic BiologyAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
RAB11A-BFP HDRT Source (pTR 145)
Plasmid#112014PurposeDNA sequence source for amplifying an HDR template to tag endogenous human RAB11A gene with BFPDepositorInsertRAB11A-BFP HDRT (RAB11A Human)
UseCRISPR and Synthetic BiologyAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
CD4-C-BFP HDRT Source (pTR 176)
Plasmid#112020PurposeDNA sequence source for amplifying an HDR template to tag endogenous human CD4 gene with BFPDepositorInsertCD4-BFP HDRT (CD4 Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
CD4-C-mCherry HDRT Source (pTR 175)
Plasmid#112019PurposeDNA sequence source for amplifying an HDR template to tag endogenous human CD4 gene with mCherryDepositorInsertCD4-mCherry HDRT (CD4 Human)
UseCRISPR and Synthetic BiologyAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 rs7732130-guide3
Plasmid#125505PurposeCRISPR-mediated activation of human islet enhancer containing T2D-associated variant rs7732130 (ZBED3 GWAS locus)DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs7732130-guide3
Plasmid#125446PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs7732130 (ZBED3 GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_ChR2_mCherry
Plasmid#213941PurposeAAV construct expressing mCherry-tagged channelrhodopsin-2 driven by PV+ basket cell-targeting enhancer. Alias: AAV_WDP0003_ChR2_mCherryDepositorHas ServiceAAV PHP.eB and AAV1InsertChannelrhodopsin 2-mCherry
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiCHATe27_ChR2_mCherry
Plasmid#213830PurposeAAV construct expressing mCherry-tagged channelrhodopsin-2 driven by cholinergic neuron-targeting enhancer. Alias: pAAV_S9E27_ChR2_mCherryDepositorHas ServiceAAV PHP.eB and AAV1InsertChannelrhodopsin 2-mCherry
UseAAVAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only