We narrowed to 10,156 results for: tre promoter
-
Plasmid#69833PurposeLentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing SpyTag-C1C2-mCherry fusion. SpyTag can be used to monitor membrane localization of the C1C2 opsin.DepositorInsertSpyTag-C1C2
UseLentiviralTagsTrafficking signal and mCherryExpressionMammalianMutationInserted SpyTag after the signal peptide of C1C2.PromoterCamKIIaAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G
Plasmid#146392PurposeInsect Expression of DmeIF4G-trunc. *Note: this plasmid does not contain an HA-tag as the name implies.DepositorInsertDmeIF4G-trunc (eIF4G1 Fly)
ExpressionInsectMutation322-1666 truncated version of elF4G sequence with…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1-F250D pET151
Plasmid#159385PurposeExpresses human TLNRD1 F250D mutant in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 F250D mutant (TLNRD1 Human)
TagsHis-tag, TEV cleavage siteExpressionBacterialMutationChanged Phenylalanine 250 to Aspartic Acid (F250D)PromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-Y2404F
Plasmid#182846Purposemutation Y2404F (TAC/TTC) in GST-TRR-C421 (TRR 2011-2431 aa). Expression in E. coli. by IPTG inductionDepositorInsertTRR 2011-2431 (trr Fly)
ExpressionBacterialMutationmutation Y2404F (TAC/TTC) in GST-TRR-C421 (TRR 20…Available SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-SPRED1-3'UTR (WT - miR-206 site)
Plasmid#62577PurposeTranslational Luciferase Reporter containing a fragment of the 3'UTR of SPRED1 containing a miR-206 binding siteDepositorInsertSPRED1 (SPRED1 Human)
UseLuciferaseAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.BRWD3-V5H
Plasmid#48624PurposeExpresses Drosophila BRWD3 (with V5 and His tags at the C-terminus) in mammalian cellsDepositorInsertBRWD3 (BRWD3 Fly)
TagsV5 and His tagsExpressionMammalianMutationno mutations, stop was removed to fuse V5His at C…PromoterCMVAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSB278 - pL0_pT16H2 (pro + 5U)
Plasmid#203889PurposeT16H2 promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertT16H2 promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI or BsaI cut site for MoClo domes…Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1224 - pL0_pT3R (pro + 5U)
Plasmid#203892PurposeT3R promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertT3R promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI or BsaI cut site for MoClo domes…Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1215 - pL0_pDAT (pro + 5U)
Plasmid#203895PurposeDAT promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertDAT promoter and 5'UTR
ExpressionPlantMutationMutation of BpiI or BsaI cut site for MoClo domes…Available SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFBgRNA9
Plasmid#196108PurposeContains guide RNA to 3' end of mouse SAFB gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196107DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM1-RRM2-V5His6_H
Plasmid#146490PurposeInsect Expression of DmPABPC1-RRM1-RRM2DepositorInsertDmPABPC1-RRM1-RRM2 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM2-RRM3-V5His6_H
Plasmid#146491PurposeInsect Expression of DmPABPC1-RRM2-RRM3DepositorInsertDmPABPC1-RRM2-RRM3 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM3-RRM4-V5His6_H
Plasmid#146492PurposeInsect Expression of DmPABPC1-RRM3-RRM4DepositorInsertDmPABPC1-RRM3-RRM4 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-V5His6_H
Plasmid#146499PurposeInsect Expression of DmGW182DepositorInsertDmGW182 (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-DmPABPC1-RRM1-RRM2-V5His6_H
Plasmid#146479PurposeInsect Expression of DmPABPC1-RRM1-RRM2DepositorInsertDmPABPC1-RRM1-RRM2 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_1-550-siRNAres_L
Plasmid#146859PurposeInsect Expression of DmPABPC1_1-550-siRNAresDepositorInsertDmPABPC1_1-550-siRNAres (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and six silent muta…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_90-635-siRNAres-V5His6_L
Plasmid#146860PurposeInsect Expression of DmPABPC1_90-635-siRNAresDepositorInsertDmPABPC1_90-635-siRNAres (pAbp Fly)
ExpressionInsectMutationfive silent mutations compared to the sequence gi…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-del91-164-V5His6_L
Plasmid#146861PurposeInsect Expression of DmPABPC1_del91-164DepositorInsertDmPABPC1_del91-164 (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and five silent mut…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only