We narrowed to 10,373 results for: EPO
-
Plasmid#114431PurposeTarget a Cre-dependent ChrimsonR-tdTomato cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertChrimsonR-tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-MKOS
Plasmid#80484PurposepiggyBac transposon for dox-inducible expression of the MKOS polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-OCT4-KLF4-cMYC
Plasmid#216175PurposeGenerate lentiviruses encoding for OCT4, KLF4 and c-MYC (polycistronic vector); used in conjunction with SOX vectors for pluripotency reprogrammingDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS
Plasmid#80480PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianMutationKlf4 [10-483]PromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OK+9MS
Plasmid#80482PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianMutationKlf4 [1-483]PromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-EB-C5
Plasmid#80485PurposepiggyBac transposon for dox-inducible expression of the EB-C5 polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRESTO-Tango Kit
Plasmid Kit#1000000068PurposeReporters to measure receptor activation for G protein-coupled receptors (GPCRs) via a modified Tango beta-arrestin recruitment assay.DepositorApplicationGene Expression and LabelingVector TypeMammalian ExpressionAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-hM3D(Gq)-mCherry (AAV5)
Viral Prep#50478-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-GFAP-hM3D(Gq)-mCherry (#50478). In addition to the viral particles, you will also receive purified pAAV-GFAP-hM3D(Gq)-mCherry plasmid DNA. GFAP-driven hM4D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPTagsmCherryAvailable SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-hM4D(Gi)-mCherry (AAV5)
Viral Prep#50479-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-GFAP-hM4D(Gi)-mCherry (#50479). In addition to the viral particles, you will also receive purified pAAV-GFAP-hM4D(Gi)-mCherry plasmid DNA. GFAP-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPTagsmCherryAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV1)
Viral Prep#50475-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV9)
Viral Prep#50475-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV5)
Viral Prep#50475-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV2)
Viral Prep#50475-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV8)
Viral Prep#50475-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM4D(Gi)-mCherry (AAV5)
Viral Prep#50477-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CaMKIIa-hM4D(Gi)-mCherry (#50477). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM4D(Gi)-mCherry plasmid DNA. CaMKIIa-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsmCherryAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry (AAV9)
Viral Prep#50476-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CaMKIIa-hM3D(Gq)-mCherry (#50476). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM3D(Gq)-mCherry plasmid DNA. CaMKIIa-driven hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM4D(Gi)-mCherry (AAV8)
Viral Prep#50477-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-CaMKIIa-hM4D(Gi)-mCherry (#50477). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hM4D(Gi)-mCherry plasmid DNA. CaMKIIa-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal silencing. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsmCherryAvailable SinceOct. 26, 2016AvailabilityAcademic Institutions and Nonprofits only