We narrowed to 25,285 results for: crispr
-
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZ8-T_dCas9
Plasmid#74062PurposepZ8-1 plasmid carrying dcas9, driven by the IPTG-inducible Ptac promoter, KanRDepositorPublicationInsertdcas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-SpCas9-HF1
Plasmid#108293PurposepX459 V2.0 (Plasmid #62988) with the N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDCC5
Plasmid#59984PurposeBi-cistronic Drosophila CRISPR/Cas9 vector, contains hsp70>Cas9-D10A nickase and U6>sgRNA cassetteDepositorInsertCas9-D10A
UseCRISPRTagsHAExpressionInsectMutationD10APromoterhsp70BbAvailable sinceOct. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHDE-35S-Cas9-mCherry-UBQ
Plasmid#78932PurposeFor CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants. Enable production of two gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAC1801_pmax-dCasRx
Plasmid#118634PurposeTransient transfection; Expresses dCasRx; CAGGS promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCasRx
ExpressionMammalianMutationR239A/H244A/R858A/H863APromoterCAGGSAvailable sinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
RPS4X sgRNA-3 lentiCRISPR v2-Blast plasmid
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS4X sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192234Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-4 lentiCRISPR v2-Blast plasmid
Plasmid#192229Purposelentiviral vector expressing sgRNA-4 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-4 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pV1382
Plasmid#111436PurposeS. cerevisiae and C. glabrata Solo CRISPR vector, marked with URA3 and NatRDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCT-tRNA
Plasmid#133813PurposeCRISPR-Cas9 system for genetic manipulation of Candida tropicalisDepositorInsertcassette for the expression of the sgRNA from the Ashbya gossypii RNA pol II TEF1 promoter
UseCRISPRAvailable sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMpGE011
Plasmid#71537PurposeFor CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMB70
Plasmid#47943PurposeCan be used to express a CRISPR guide RNA in C. elegans from U6 regulatory sequencesDepositorPublicationInsertguide RNA
UseCRISPRExpressionWormAvailable sinceOct. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFYF1548 EMX1
Plasmid#47508Purposehuman gRNA expression vector targeting EMX1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA-EMX1 (EMX1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by