We narrowed to 56,058 results for: uros
-
Plasmid#241369PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLVX-IRES-PURO-RAC1-Y64F
Plasmid#241370PurposeLentiviral expression of mutant Rac1DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-E14-ABE-Cas9n-puro
Plasmid#226588PurposeExpress E14-ABE in mammalian cellsDepositorInsertE14-ABE
UseCRISPRExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28a-His6-GFP-UROD-N367A
Plasmid#236742PurposeProtein overexpression of eGFP-human uroporphyrinogen decarboxylase N367ADepositorInserteGFP-Uroporphyrinogen decarboxylase human N367A (UROD Human, Synthetic)
TagsHis6 and eGFPExpressionBacterialMutationN367AAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
TagsiRFP713ExpressionMammalianPromoterCAG promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SV40-puro-EF1a-HA-NLGN1dAChE-bc
Plasmid#220437PurposeExpresses HA-tagged human NLGN1 with K578A/V579A substitutionsDepositorInsertNeuroligin-1 (NLGN1 Human)
UseLentiviralTagsHA-tagExpressionMammalianMutationK578A and V579A substitutionsPromoterEF1aAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
Plasmid#239448PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.DepositorInsertsS.p. gRNA backbone
S.a. gRNA backbone
PuroR-T2A-BFP(C>T_screening)
UseLentiviralExpressionMammalianMutationBFP: T65S, S72S, V145F, K206K, H231LPromoterEF1alpha, U6, and mU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA595 - pBA904 Puro-T2A-mCherry
Plasmid#238171PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA594 - pBA904 Puro-T2A-BFP
Plasmid#238170PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmTagBFP2Available SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Alpha-VA
Plasmid#191217PurposeLentiviral expression of SARS-CoV-2 Spike_Alpha in mammalian cellsDepositorInsertSPIKE_SARS2_Alpha (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationDel 69-70 Del 144 N501Y A570D D614G P681H T716I S…PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Delta-VA
Plasmid#191219PurposeLentiviral expression of SARS-CoV-2 Spike_Delta in mammalian cellsDepositorInsertSPIKE_SARS2_Delta (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationT19R 156del 157del R158G L452R T478K D614G P681R …PromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Lambda-VA
Plasmid#191220PurposeLentiviral expression of SARS-CoV-2 Spike_Lambda in mammalian cellsDepositorInsertSPIKE_SARS2_Lambda (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationG75V T76I Del 246-252 L452Q F490S D614G T859NPromoterCMVAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Lenti CMV EGFP-HA Puro
Plasmid#236082PurposeLentiviral backbone expressing C-terminally HA tagged EGFP, control for empty backbone 236080DepositorInsertEGFP
UseLentiviralTagsHAPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-PGK-TetOn-Puro_MeltITSN1-37-mch
Plasmid#234068PurposeEncodes the Dbl homology and pleckstrin homology (DH-PH) domain of Intersectin1 controlled by a Melt variant with a switching temperature of 37°CDepositorInsertMeltITSN1-37-mCherry
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only