We narrowed to 25,285 results for: crispr
-
Plasmid#227673PurposePegRNA for 53 bp insertionDepositorAvailable sinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SpG_ATH51-IP
Plasmid#242074PurposeExpresses Cas9-SpG_ATH51 in mammalian cellsDepositorInsertSpG_ATH51
UseCRISPRExpressionMammalianMutationectopic insertion of 7 amino acids of PID turn-he…Available sinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG438
Plasmid#165486PurposeVector for expression of the SpCas9 VRKG variant in human cells: CMV-T7-humanVRKG(SpCas9, D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFLAGDepositorInsertMammalian codon-optimized Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G)-1xNLS(SV40)-3xFlag
UseCRISPRTags3x FLAG and SV40 NLSExpressionMammalianMutationD1135V, S1136R, D1332K, and R1333G mutations in S…PromoterCMV and T7Available sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pC0045-EF1a-PguCas13b-NES-HIV
Plasmid#103861PurposeExpresses PguCas13b in mammalian cells for knockdown of target RNAs in combination with compatible guide RNAs. Localized to the cytoplasmDepositorInsertPguCas13b
UseCRISPR and LentiviralTags3xHA and HIV NESExpressionMammalianAvailable sinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCas9-polyA
Plasmid#72602Purposeexpress hCas9 byT7 promoter with polyadenine tailsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-polyadenine
Tags81-bp polyadenylationPromoterT7Available sinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJJR81
Plasmid#75029PurposetagBFP2^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInserttagBFP2^SEC^3xFlag
UseCRISPRTags3xFLAG and C. elegans codon optimized tagBFP2ExpressionWormAvailable sinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEG302 22aa SunTag NtDRMcd (noNLS) nog
Plasmid#119554PurposeCRISPR-Cas9 SunTag system to target NtDRMcd (without an NLS) to specific loci of interest (nog=no guide)DepositorInsertNOS_NLS_GB1_noNLS_linker_DRMcd_linker sfGFP_scFv_UBQ10_Insulator UBQ10_Ω dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-HypaCas9
Plasmid#108302PurposepX330 (Plasmid #42230) with the N692A, M694A, Q695A, and H698A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHAGE-NLS-dPguCas13b-3xmRuby3-NLS
Plasmid#132406Purposeoverexpression in human cellsDepositorInsertdPguCas13b
UseLentiviralExpressionMammalianMutationH151A; H1121AAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-3-EF1a-LibVec
Plasmid#239596Purposeexpresses guide#3 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-1-EF1a-LibVec
Plasmid#239594Purposeexpresses guide#1 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-2-EF1a-LibVec
Plasmid#239595Purposeexpresses guide#2 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC-H1-gRNA
Plasmid#61089PurposeCRISPR/Cas9 system gRNA cloningDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH1 promoter; gRNA sequences
UseCRISPR; /cas9 grna cloning vectorExpressionMammalianPromoterH1Available sinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLCHKO_GFP_Luciferase
Plasmid#155079PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting GFP and Luciferase using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas-hHDAC3-R265P
Plasmid#103786PurposeExpresses dCas9 fused to human HDAC3 with R265P mutationDepositorInsertdCas9-HDAC3-R265P (HDAC3 S. pyogenes, Human, Synthetic)
UseCRISPR and LentiviralExpressionMammalianMutationChanged arginine 265 to prolinePromoterEF1AAvailable sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHDE-35S-Cas9-mCherry
Plasmid#78931PurposeFor CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plantsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-puro
Plasmid#106965Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralExpressionMammalianPromoterEFSAvailable sinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only