We narrowed to 5,504 results for: crispr cas9 grna plasmid
-
Plasmid#126760PurposeExpression plasmid for human codon-optimized Blackjack-SpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than that of WT SpCas9.DepositorInsertB-SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationamino acids 1005-1013 replaced with two glycinePromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9
Plasmid#126766PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9.DepositorInsertB-HeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; K848A; Q926A; K1003A; R1060A…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-eSpCas9
Plasmid#126761PurposeExpression plasmid for human codon-optimized increased fidelity Blackjack-eSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than eSpCas9.DepositorInsertB-eSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A; K1003A; R1060A; amino acids 1005-1013 repl…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-evoSpCas9
Plasmid#126765PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-evoSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than evoSpCas9.DepositorInsertB-evoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V; Y515N; K526E; R661Q; amino acids 1005-1013…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HypaSpCas9
Plasmid#126763PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HypaSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HypaSpCas9.DepositorInsertB-HypaSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN692A; M694A; Q695A; H698A; amino acids 1005-1013…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
Plasmid#118154PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationSee depositor comments belowPromoterEF1a core and U6Available SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-EGFP
Plasmid#71666PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-EGFP for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-EGFP (DNMT3A S. pyogenes, Synthetic, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR
Plasmid#71667PurposeExpression of human codon-optimized dCas9-DNMT3A fusion with T2A-PuroR for targeted DNA methylation in mammalian cells; cloning backbone for sgRNADepositorInsertS. pyogenes dCas9 fused with the catalytic domain of human DNMT3A (amino acids P602-V912) and T2A-PuroR (DNMT3A S. pyogenes, Synthetic, Human)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterCBhAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK1289-AAV-dCjCas9
Plasmid#223138PurposeAAV backbone for dCjCas9 (endonuclease dead Cas9 from Campylobacter jejuni) with Cj-gRNA scaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1290-AAV-dSaCas9
Plasmid#223139PurposeAAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP
Plasmid#64216PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFPExpressionMammalianPromoterCBh and U6Available SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMGS7 (AAVS1sgRNA)
Plasmid#126582PurposeA CRISPR/Cas9 construct to target the AAVS1 locus in humansDepositorInsertAAVS1 sgRNA
ExpressionMammalianAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Nanog_2
Plasmid#174871PurposeCRISPR vector for generating Nanog STREAMING-tag KI cellDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCas9-VPR
Plasmid#68497Purposenuclease competent SP-Cas9 fused to VPRDepositorInsertSP-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR
Plasmid#60231PurposeExpresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning.DepositorInsertssgRNA
Cre recombinase
EGFP
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HA-P2A and EGFP-KASHExpressionMammalianPromoterU6 and hSynAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-TRE3G-Nluc
Plasmid#192659PurposeA plasmid encoding TRE3G sgRNA and TRE3G-promoter-NlucDepositorInsertNluc
UseLuciferaseExpressionMammalianPromoterU6, TRE3GAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only