We narrowed to 4,161 results for: SPL
-
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBS1506 [IBB-GFP-mCherry3E]-[BFP-TDP43 FYW-L]
Plasmid#133330PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll FYW to L in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1507 [IBB-GFP-mCherry 3E]-[BFP-TDP43 VLIM-S]
Plasmid#133331PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll VLIM to S in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1508 [IBB-GFP-mCherry 3E]-[BFP-TDP43 VLIM-F]
Plasmid#133332PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll VLIM to F in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-Caspase-1 (C285A) -NpLxIS
Plasmid#131354PurposeExpresses Caspase-1 C285A with 2 copies of pLxIS motif from STING fused to its N-ternimusDepositorInsertCaspase-1 (C285A)-NpLxIS (Casp1 Mouse)
UseRetroviralExpressionMammalianMutationCaspase-1 (C285A)Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Trf2
Plasmid#125159PurposeGateway entry cloneDepositorInsertTrf2 (Trf2 Fly)
UseGateway CloningAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1delta
Plasmid#124150PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1401 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 F-S]
Plasmid#118808PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll F to S in CTD of full-length TDP43Available SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
HM110 prp16-2
Plasmid#111277Purposeprp16-2 in pSE358(Trp)DepositorInsertPRP16
ExpressionYeastMutationprp-2 (D575N)Available SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
UBQ10:sXVE:ATG-3xHA-S11
Plasmid#108238PurposeBinary vectors used for the inducible expression of tripartite split-sfGFP components (3xHA-S11 as control) in plantsDepositorInsertATG-3xHA-S11
UseSynthetic BiologyExpressionPlantPromoterUBQ10:sXVE:Available SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBS1201 [IBB-GFP-mCherry3E]-[BFP-P2A-TDP43 6xΦ]
Plasmid#107846PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll hydrophobics combined in six clusters in spli…Available SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CIPK5-YFPn-1
Plasmid#102392Purposesplit YFP. Plant expression of CIPK5-YFPn-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CIPK5-YFPc-1
Plasmid#102387Purposesplit YFP. Plant expression of CIPK5-YFPc-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only