For specific A-to-G base editing to introduce targeted A-to-G mutation in nad7 in mitochondria

Sept. 10, 2024

gRNA expression cassette in pENTR4

May 12, 2023

EFF-1::V5

Dec. 4, 2019

Synaptogyrin-CRY2 (E490G + residues 1-535) (CRY2, sng-1 Nematode, Mustard Weed)

July 10, 2024

AtU6-1 promoter

Aug. 5, 2016

crCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)

March 27, 2024

SD3(1-50)

Sept. 6, 2016

For specific A-to-G base editing to introduce targeted A-to-G mutation in ATP6-2 in mitochondria

Sept. 10, 2024

For specific A-to-G base editing to introduce targeted A-to-G mutation in 16S rRNA in chloroplast

Sept. 10, 2024

AtUbi10

May 9, 2022