We narrowed to 20,741 results for: RAN-1
-
Plasmid#74962PurposeCas9 + sgATXN1L-1 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pXPR_BRD003 sgATXN1L-1
Plasmid#74970PurposesgATXN1L-1, puromycin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
hV1b-GFP-1
Plasmid#67847Purposemammalian expression of human V1b receptor with GFP tagDepositorAvailable SinceOct. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgFXN-1
Plasmid#246017PurposeAll-in-one CRISPRko plasmid containing Cas9 and guide RNA targeting FXNDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFS_0271_pET30_pCat-tetR-Term-ptetA-sfGFP-rrnBterm_Fusicatenibacter_saccharivorans_ARRAY2_FaqI
Plasmid#116955PurposeExpresses FsRT-Cas1-Cas2 under pT7lac and sfGFP under ptetA promoter, encodes FsCRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFS_0272_pET30_pCat-tetR-Term-ptetA-Rluc-rrnBterm_Fusicatenibacter_saccharivorans_ARRAY2_FaqI
Plasmid#116956PurposeExpresses FsRT-Cas1-Cas2 under pT7lac and Rluc under ptetA promoter, encodes FsCRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
MIGR1-Cdc42-1
Plasmid#179517PurposeRetroviral expression of Cdc42 splice variant 1DepositorAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2
Plasmid#196860PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2DepositorInsertNedd1-mOrange2 (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHS0667 KraIscB-1 non-coding locus in pCOLADuet-1
Plasmid#176537PurposeNon-protein coding locus components from KraIscB-1DepositorInsertnon-coding locus components from KraIscB-1 locus
ExpressionBacterialAvailable SinceNov. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmPAN2_1-358-dsRANres_Y
Plasmid#148059PurposeInsect Expression of DmPAN2_1-358-dsRNAresDepositorInsertDmPAN2_1-358-dsRNAres (PAN2 Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTC62.6-dmd-1, full ORF, splice form 1
Plasmid#45028DepositorInsertSmed-dmd-1, full ORF, spice form 1
UseT/a cloning vector for dsrna generation and the g…Available SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
SacI ML GFP Strand 11 Long
Plasmid#164120PurposeDetect the long Mitochondria-Endoplasmic reticulum contact along with the OMMGFP1-10DepositorInsertSacI ML GFP Strand 11 Long
ExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
SacI ML GFP Strand 11 Short
Plasmid#164121PurposeDetect the short Mitochondria-Endoplasmic reticulum contact along with the OMMGFP1-10DepositorInsertSacI ML GFP Strand 11 Short
ExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
RANLS-DEVD-BNES
Plasmid#50840PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-3 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
TagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
RANLS-IETD-BNES
Plasmid#60972PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-8 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
TagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
ZP16 Wnt-1
Plasmid#16925DepositorInsertwnt-1 (wnt1 Zebrafish)
ExpressionBacterialAvailable SinceFeb. 1, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGHE-PdNIP2-1
Plasmid#108447PurposePdNIP2-1 gene from Date Palm (Phoenix dactylifera) cloned in pGHE. Can be used for Xenopus oocyte assay. The vector has Xenopus globin 3UTR and 5UTR, pT7, and polyA.DepositorInsertPdNIP2-1
PromoterpT7Available SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2-F75A
Plasmid#196862PurposeExpression of Need1-rCM1 harboring a (F75A) mutation in the rat (r) Centrosomin motif 1 (CM1) and fused to mOrange2. F75A mutatuon renders CM1 incapable of binding and activating gamma-TuRCDepositorInsertNedd1-mOrange2-F75A (Nedd1 Rat)
ExpressionMammalianMutationF75A in the CM1 domainPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
J-DHTKD1A-1
Plasmid#166524PurposescFv of a human scaffold targeting Dehydrogenase E1 and transketolase domain containing protein 1. Antigen coverage aa 45-919 of 919DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only