We narrowed to 4,891 results for: Abo
-
Plasmid#66084PurposeG protein alpha-s internally tagged with mCerulean and EE epitopeDepositorInsertG-alpha-s-EE-mCerulean (Gnas Rat, Aequorea victoria)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-7 in pcDNAI/Amp
Plasmid#54473PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-7. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α promoter (1.1kb short version)Available SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMB2_sgRNA_1
Plasmid#155092Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMB2 (core essential gene)DepositorInsertPSMB2_sgRNA_1 (PSMB2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX_307-SOD1E133Δ
Plasmid#83445PurposeMammalian expression of SOD1E133Δ.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_PSMD1_sgRNA_1
Plasmid#155107Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-1 in pcDNAI/Amp
Plasmid#55615PurposeAn amino-terminal CFP fragment was fused to Ggamma-1. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-1 (GNGT1 Bovine, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55616PurposeAn amino-terminal CFP fragment was fused to Ggamma-2. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP (1-158)-gamma-2 (Gng2 Mouse, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSOD1E133K-AcGFP1
Plasmid#83442PurposeExpresses SOD1E133K in mammalian cells.DepositorAvailable SinceNov. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-10 in pcDNAI/Amp
Plasmid#55192PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-10. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP-(159-238)-gamma-10 (GNG10 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-12 in pcDNAI/Amp
Plasmid#55194PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-12. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-12 (GNG12 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-IRES2-MCS
Plasmid#212660PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and a multiple cloning site (MCS) after an IRES sequenceDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x- GCaMP6f-IRES2-rat-Letm1-ΔEFhand
Plasmid#212662PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and rat-Letm1 with mutations in its EF-handDepositorInsertsUseLentiviralExpressionMammalianMutationD676A, D680AAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1α-EGFP-WPRE
Plasmid#250407PurposeLentiviral expression of EGFP under EF1α core promoter.DepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1α-PPAT-WPRE
Plasmid#250408PurposeLentiviral expression of PPAT under EF1α core promoter.DepositorAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only