We narrowed to 10,104 results for: transfer
-
Plasmid#109323PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human TARDBPDepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV.hSynap-FLEX.SF-Venus-iGluSnFR.A184V
Plasmid#106184PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterhSynapsinAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_3xFlag-6His-nsp15 (SARS-CoV-2)
Plasmid#169166PurposeBaculoviral transfer vector for the expression of SARS-CoV-2 nsp15 in insect cellsDepositorInsert3xFlag-6His-nsp15 (ORF1ab SARS-CoV-2, Synthetic)
Tags3xFlag-6HisExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
J7AAV-HDR Fah.2
Plasmid#73451PurposeJ7AAV-HDR U6sgFah.2 template2 to repair Fah mutationDepositorInsertFah (Fah Mouse)
UseAAVAvailable SinceFeb. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SF-Venus-iGluSnFR.A184V
Plasmid#106196PurposeMedium affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.A184V
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: A184VPromoterGFAPAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.SF-Venus-iGluSnFR.S72A
Plasmid#106197PurposeWeak affinity yellow glutamate sensor ** A newer version of this sensor is available. Please see iGluSnFR3 plasmids at https://www.addgene.org/browse/article/28220233/ **DepositorInsertSF-Venus-iGluSnFR.S72A
UseAAVMutationSFGFP: T203Y, F46L, T65G, S72A GltI: S72APromoterGFAPAvailable SinceApril 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -hKCNJ2
Plasmid#246998PurposeCan be used to generate AAV virus that will express human KCNJ2 from EF1α core promoterDepositorAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-U6-gIl1r1-CBh-mCherry-SV40late
Plasmid#249121Purposeexpression of gIl1r1 and mCherryDepositorAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-KIKO-U6-gThy1-p2a-mCherry-STOP-pA-400
Plasmid#249129Purposeall-in-one HDRT-based knockin-knockout (KIKO) design to insert mCherry (=knockin) at gThy1 cut site, disrupting Thy1 expression (=knockout)DepositorInsertgThy1, mCherry (Thy1 Mouse, Synthetic)
UseAAVAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Camk2a(short)-mRFP1.Letm1[miR30-shRNA]-WPRE
Plasmid#214404PurposeExpresses a mouse Letm1 specific microRNA in tandem with mRFP1DepositorInsertmRFP1 with Letm1 specific miRNA
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Camk2a(short)-mRFP.Scramble[miR30-shRNA]-WPRE
Plasmid#214405PurposeExpresses a control non-specific microRNA in tandem with mRFP1DepositorInsertmRFP1 with non-specific control miRNA
UseAAVAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α-DIO-DSE-mCherry-PSE-shRNA-Scramble
Plasmid#250237PurposeCre-dependent AAV expressing mCherry and a scrambled shRNA under EF1α promoter. Used as a non-targeting control for shRNA knockdownDepositorInsertshRNA-Scramble (SMARCA4 Synthetic)
UseAAV, Cre/Lox, Mouse Targeting, RNAi, and Syntheti…ExpressionMammalianPromoterEF1αAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-DIO-optoFGFR1-HA
Plasmid#250235PurposeCre-dependent AAV expressing light-activatable FGFR1 (optoFGFR1-HA) for temporally precise control of neuronal FGFR1 signalingDepositorAvailable SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFB-EF1a-DIO-Rpl22l1-3xFLAG-2A-GFP
Plasmid#245377PurposeCre-dependent expression of FLAG-tagged Rpl22l1 and EGFP.DepositorAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-GRN-HA
Plasmid#243760PurposeAAV plasmid expressing human GRN with a C-terminal HA tag under the CAG promoter.DepositorAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-deLACCO1-COBRA
Plasmid#223344PurposeBiosensor for extracellular L-lactateDepositorInsertdeLACCO1
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-eLACCO2-COBRA
Plasmid#223345PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-IgK-R-eLACCO2.1-COBRA
Plasmid#223346PurposeBiosensor for extracellular L-lactateDepositorInserteLACC02.1
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-IgK-R-eLACCO2-COBRA
Plasmid#223348PurposeBiosensor for extracellular L-lactateDepositorInserteLACCO2
UseAAVTagsGPI-COBL9 AnchorAvailable SinceSept. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2
Plasmid#240865PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
Plasmid#240094PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1_SypHer3s_mito
Plasmid#238972PurposeMammalian neurons SypHer3s expression targeted to the mitochondrial matrixDepositorInsertSypHer3s
UseAAVTags3x Cytochrome C Oxidase Subunit VIII presequenseExpressionMammalianPromoterhSyn1Available SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgNT-2-EF1a-LibVec
Plasmid#239593Purposeexpresses non-targeting (NT) guide#2DepositorInsertNT (non-targeting guide)
UseAAV; To deliver a non-targeting guide (serving as…PromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgNT-1-EF1a-LibVec
Plasmid#239592Purposeexpresses non-targeting (NT) guide#1DepositorInsertNT (non-targeting guide)
UseAAV; To deliver a non-targeting guide (serving as…PromoterhU6Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ClipF-HA-2a-Hu VGAT sesRNA-2a-smV5-2a-tTA2-WPRE
Plasmid#239031PurposeExpression of ClipF, sesRNA in mammalian cells, with smV5 and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM1 WPRE
Plasmid#236233PurposeAAV expression of mouse STIM1 internally tagged with HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-CAG_G-PTEN
Plasmid#227438PurposeAn AAV backbone for expression of the G-PTEN sensor under the CAG promoter, in a Cre dependent manner.DepositorInsertG-PTEN sensor (Pten Rat)
UseAAVTagsCD-sREACh and mEGFPExpressionMammalianMutationR14GPromoterpCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC131_CCR5(SFFV-synEPOR-2A-YFP)
Plasmid#232412PurposeAAV production plasmid for SFFV(synEPOR) vector from Figs. 2-3 that mediates HDR at CCR5 locus using CCR5 gRNA. YFP is followed by BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC175_HBA1reg(synEPOR)
Plasmid#232413PurposeAAV production plasmid for HBA1 UTRs vector from Fig. 3 that mediates HDR at HBA1 locus using HBA1 sg5 gRNA. HBB gene includes introns; HBA1 UTRs flank H+C15BA1 cassette. HAs are ~400bp each.DepositorAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only