We narrowed to 10,314 results for: Rras
-
Plasmid#27197DepositorInsertZinc finger array targeting hnf1a (hnf1a Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
hnf1a_L (OZ521)
Plasmid#27196DepositorInsertZinc finger array targeting hnf1a (hnf1a Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
Kif6_L (OZ537)
Plasmid#27214DepositorInsertZinc finger array targeting Kif6 (kif6 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
Kif6_R (OZ538)
Plasmid#27215DepositorInsertZinc finger array targeting Kif6 (kif6 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
GUSB_L (OZ551)
Plasmid#28076DepositorInsertZinc finger array targeting GUSB (gusb Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
GUSB_R (OZ552)
Plasmid#28077DepositorInsertZinc finger array targeting GUSB (gusb Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
dpf2_L (OZ531)
Plasmid#27208DepositorInsertZinc finger array targeting dpf2 (dpf2 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
dpf2_R (OZ532)
Plasmid#27209DepositorInsertZinc finger array targeting dpf2 (dpf2 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceJan. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_DDX3X_MRAS
Plasmid#205803PurposeExpress mEGFP-tagged fusion protein, DDX3X_MRAS from patient-derived sequenceDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPYD
Plasmid#195478PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 1 - 92 (the resulting pyrin protein lacks the PYD domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 1-92 of pyrin (the PYD domai…PromoterAvailable sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-S580X
Plasmid#195474PurposepInducer21 plasmid containing the human MEFV gene with the S580X mutation (stop codon leading to the truncation of the B30.2 domain of the pyrin protein) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationchanged S580 to a stop codonPromoterAvailable sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-UbC-3xNLS-mScarlet-I
Plasmid#191099PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-mScarlet-I
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationoptimized to human codon usagePromoterUbCAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.351.v4
Plasmid#173788PurposeMammalian expression of SARS-CoV-2 Spike protein South African variant version 4DepositorInsertSpike (S-GSAS-B.1.351 variant version 4) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_THAS1
Plasmid#103859PurposeHeterologous, cobalt-inducible expression of SQE1 and THAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertthalianol synthase 1 (THAS1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_MRN1
Plasmid#103858PurposeHeterologous, cobalt-inducible expression of SQE1 and MRN1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertmarneral synthase 1 (MRN1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted genes are codon optimized2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_CAS1
Plasmid#103856PurposeHeterologous, cobalt-inducible expression of SQE1 and CAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertcycloartenol synthase 1 (CAS1 Mustard Weed)
UseSynthetic BiologyTagsExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available sinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
im:7163548_L (OZ571)
Plasmid#35211DepositorInsertZinc finger array targeting im:7163548 (im:7163548 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
zgc:162148_L (OZ579)
Plasmid#35219DepositorInsertZinc finger array targeting zgc:162148 (micu1 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
im:7163548_R (OZ572)
Plasmid#35212DepositorInsertZinc finger array targeting im:7163548 (im:7163548 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-R914W_EGFP-PEST_reporter
Plasmid#172596PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-R914W mutant signaling.DepositorInsertmyc-PDGFRA-R914W (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-R914WPromoterCMVAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
mdka (midkine-related growth factor)_R (OZ528)
Plasmid#27205DepositorInsertZinc finger array targeting mdka (mdka Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
mdka (midkine-related growth factor)_L (OZ527)
Plasmid#27204DepositorInsertZinc finger array targeting mdka (mdka Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
CACNA1D (2of2) or cav1.3b_L (OZ547)
Plasmid#28072DepositorInsertZinc finger array targeting CACNA1D (2of2) or cav1.3b (cacna1db Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
CACNA1D (2of2) or cav1.3b_R (OZ548)
Plasmid#28073DepositorInsertZinc finger array targeting CACNA1D (2of2) or cav1.3b (cacna1db Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceFeb. 25, 2011AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-N317P
Plasmid#196378PurposeMammalian cell expression of SARS-CoV-2 Spike protein with mutation N317P with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-2P-N317P (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPLD
Plasmid#195479PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 88 - 310 (the resulting pyrin protein lacks the Phosphorylated Linker Domain domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 88 - 310 (the resulting pyri…PromoterAvailable sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-D842V_EGFP-PEST_reporter
Plasmid#172598PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-D842V mutant signaling.DepositorInsertmyc-PDGFRA-D842V (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-D842VPromoterCMVAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-D842V+R914W_EGFP-PEST_reporter
Plasmid#172599PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-D842V+R914W mutant signaling.DepositorInsertmyc-PDGFRA-D842V+R914W (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-D842V+R914WPromoterCMVAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-K627R+R914W_EGFP-PEST_reporter
Plasmid#172600PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-K627R+R914W mutant signaling.DepositorInsertmyc-PDGFRA-K627R+R914W (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-K627R+R914WPromoterCMVAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-K627R_EGFP-PEST_reporter
Plasmid#172597PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-K627R mutant signaling.DepositorInsertmyc-PDGFRA-K627R (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-K627RPromoterCMVAvailable sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d
Plasmid#183516PurposeMammalian cell expression of SARS-CoV-2 Spike protein S-GSAS-rS2d with (682-685) furin side replaced with GSAS and mutation S383C, D985CDepositorInsertrS2d (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_L (OZ535)
Plasmid#27212DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
zebrafish similar to gpr151 (or gpcr-2037)_R (OZ536)
Plasmid#27213DepositorInsertZinc finger array targeting zebrafish similar to gpr151 (or gpcr-2037) (LOC565170 Zebrafish)
UseZebrafish targetingTagsExpressionMutationPromoterAvailable sinceJan. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR A757
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
UseTagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…PromoterAvailable sinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-rS2d-HexaPro
Plasmid#183515PurposeMammalian cell expression of SARS-CoV-2 Spike protein rS2d-HexaPro with (682-685) furin side replaced with GSAS and mutation S383C, D985C, F817P, A892P, A899P, A942P, K986P,V987PDepositorInsertSpike (S-GSAS-rS2d.HexaPro) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.5
Plasmid#213069PurposeMammalian cell expression of SARS-CoV-2 Spike protein of Omicron.5 variantDepositorInsertS-GSAS-Omicron.BA5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterCMVAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.2
Plasmid#184829PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON.BA.2 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA.2 (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.617.2.v1
Plasmid#182575PurposeMammalian cell expression of SARS-CoV-2 Spike protein Delta variant, furin side replaced by GSAS, 2 Proline at 986 and 987 plus T19R-G142D-del156/157-R158G-L452R-T478K-D614G-P681R-D950NDepositorInsertSpike S-GSAS-B.1.617.2.v1 (T19R-G142D-Del156/157-R158G-L452R-T478K-D614G-P681R-D950N) (S Severe acute respiratory syndrome coronavirus 2)
UseTags2X Strep-Tag II, 8X His tag, and HRV3C cleavage s…ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/EG.5.1
Plasmid#218668PurposeMammalian cell expression of SARS-CoV-2 Spike protein of OMICRON.EG.5.1 variantDepositorInsertpαH-S-GSAS/EG.5.1 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterCMVAvailable sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS/EG.5
Plasmid#212990PurposeMammalian cell expression of SARS-CoV-2 Spike protein of OMICRON.EG5 variantDepositorInsertpαH-S-GSAS/EG.5 (S )
UseTagsHRV 3C cleavage site (before tags) C terminal on …ExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterCMVAvailable sinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-2P-OMICRON
Plasmid#180593PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertSpike (S-GSAS-2P-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON
Plasmid#180423PurposeMammalian cell expression of SARS-CoV-2 Spike protein variant OMICRON with furin side replaced by GSASDepositorInsertSpike (S-GSAS-OMICRON) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
B. subtilis CRISPRi Essential Gene Knockdown Library
Plasmid Kit#1000000116PurposeB. subtilis CRISPRi Essential Gene Knockdown Library: Arrayed library that uses CRISPRi to sterically hinder transcription and therefore knock down expression of essential genes.DepositorAvailable sinceSept. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
B. subtilis Single Gene Deletion Library--Kanamycin
Plasmid Kit#1000000115PurposeB. subtilis Single Gene Deletion Library - Kanamycin: Arrayed deletion library in which each non-essential gene has been individually replaced with a kanamycin resistance cassette.DepositorAvailable sinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
Yamamoto Lab TALEN Accessory Pack
Plasmid Kit#1000000030PurposeContains modified pFUS array vectors and destination vectors that are designed for use with the Golden Gate TALEN and TAL Effector Kit.DepositorAvailable sinceMarch 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
Phosphoinositide Biosensors Kit
Plasmid Kit#1000000261PurposeUse the phosphoinositide biosensors kit to detect the whole family of phosphoinositides in fixed cells and tissues.DepositorAvailable sinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Zinc Finger Consortium Expression Vector Kit v1.0
Plasmid Kit#1000000010PurposeContains plasmids and strains for the bacterial two-hybrid (B2H) system used to screen zinc finger arrays for activity. Also called the Modular Assembly Accessory Reagents Kit.DepositorAvailable sinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only