We narrowed to 13,231 results for: CAD
-
Plasmid#135519PurposeMammalian expression of myc-tagged H2-LdDepositorInsertH2-Ld
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TREX-GFP-FF3
Plasmid#11667Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a Tet-responsive promoter (TREX) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-UVRAG CC
Plasmid#24400DepositorInsertUVRAG (UVRAG Human)
TagsHisExpressionBacterialMutationContains on the CC domain, amino acids 200-270Available SinceApril 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Fah_W
Plasmid#163087Purposeexpressing mouse wild type FAH in mammalian cellsDepositorInsertFah_W
TagsMyc-HisExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 Flag BimL (AA)
Plasmid#24240DepositorInsertBim L(AA) (BCL2L11 Human)
TagsFlagExpressionMammalianMutationchanged Threonine 56 to Alanine changed Serine …Available SinceMay 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK8-ElonginB
Plasmid#29504DepositorInsertElongin B (ELOB Human)
ExpressionInsectAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pG4-E6s-luc
Plasmid#46324DepositorInsert5xGal4
UseLuciferaseTagsE boxes and luciferaseExpressionMammalianMutationfive copies of a multimerized GAL4 (5×GAL4) site …Available SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCC20
Plasmid#198783PurposeDrives specific expression in the ASK neuronsDepositorInsertPsra-9-GAL4-SK(DBD)-VP64
ExpressionWormAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-MTS-FLAG-LOV*
Plasmid#202208PurposePlasmid for the generation of a lentiviral vector encoding the photoproximity labeling catalyst LOV* fused to the mitochondria targeting sequence (MTS) in mammalian cellsDepositorInsertCytochrome c oxidase subunit 4 isoform 1, mitochondrial, aa 1-24
UseLentiviralTagsFLAG and LOV*PromoterEf1aAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
RNA polymerase beta prime subunit FLAG
Plasmid#102337PurposeTargeting plasmids for replacing the S. elongatus PCC 7942 genomic copy of Synpcc7942_1524 (Beta prime subunit of RNA polymerase) with a C-terminal FLAG tagged variant.DepositorInsertRNAP Beta Prime Subunit with C-terminal FLAG TAG
Tags3x FLAG with 3X GSGS linkerAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOPS0385
Plasmid#133235PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), gusA (pOGG083) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0386
Plasmid#133236PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), celB (pOGG050) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0383
Plasmid#133233PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), sfGFP (pOGG037) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSSK p85 alpha (delta BH)
Plasmid#13431DepositorInsertp85 alpha (delta BH) (PIK3R1 Human)
TagsFLAGExpressionBacterialMutationBH domain replaced by flag tag.Available SinceNov. 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRRG227-Wnt1
Plasmid#99073PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea Wnt1 (also known as WntP-1)DepositorInsertWnt1 (also known as WntP-1) in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K29,30A)-mVenus
Plasmid#168485PurposeMammalian expression of the K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
ExpressionMammalianAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV4-Flag-mIL-17RA/YFP.Hygro
Plasmid#46862Purposeencodes Flag-tagged mouse IL-17RA fused to Yellow Fl. ProteinDepositorInsertIL-17RA-YFP
TagsFlag/IL-3 signal sequence and fused to CFPExpressionMammalianPromoterCMVAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRQ-Id1HA
Plasmid#18112DepositorAvailable SinceJan. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
GST-SmB'
Plasmid#1842DepositorAvailable SinceAug. 3, 2006AvailabilityAcademic Institutions and Nonprofits only