We narrowed to 9,668 results for: CAG
-
Plasmid#155076PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 Mouse, sequence: GTCGCTACCTACAGCCAGGA)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
AA324
Plasmid#215953PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0[EnAs]; sgCD46_v4[EnAs]; DR_v1[EnAs]; sgCD47_v2[EnAs]; DR_v2[EnAs]; sgCD55_v4[EnAs];DR_v3[EnAs];sgCD81_v4[EnAs]}
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt PHGDH
Plasmid#209409PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertPhgdh shRNA (Phgdh Mouse)
UseRetroviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
TK4-NLS-EGFP
Plasmid#239046PurposePiggyBac plasmid for stable transgene expression during human pluripotent stem cell differentiationDepositorInsertsEGFP
puroR-T2A-mycNLS-mTagBFP2
TagsT2A-mycNLS-mTagBFP2 and c-myc-NLSExpressionMammalianPromoterCAG and EF1aAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
TagsHA and YFP (Venus)ExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJOP-HTT-HR18Q
Plasmid#87228PurposeHTT HR arms with 18 CAG repeats and piggyBac selection cassetteDepositorInsert1.7kb HTT 5' homology arm, 2.5kb HTT 3' homology arm
ExpressionMammalianPromoterEF1a driving selection cassetteAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
TK4-EGFP
Plasmid#239047PurposePiggyBac plasmid for stable transgene expression during human pluripotent stem cell differentiationDepositorInsertsEGFP
puroR
ExpressionMammalianPromoterCAG and EF1aAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCE-hSK
Plasmid#41814PurposeNon-integrating (episomal) expression of human SOX2 and KLF4DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-PEmax
Plasmid#187893PurposeAll-in-one prime editor piggyBac transposon with PEmaxDepositorInsertSpCas9_H840A_KK-MMLV-RT_co-P2A-PAC_dTK
UseCRISPR and Synthetic Biology; Piggybac transposonTagsBPSV40 NLS and c-Myc NLSExpressionMammalianPromoterCAGAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER21 (ORF-EG)
Plasmid#46948PurposeInducible lentiviral gene expression vector. Chloramphenicol cm + ccdB cassette may be removed to clone in gene of interestDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr-6080NES(Epac-sensor)
Plasmid#162487PurposehyBRET-Epac, an Epac biosensor based on fluorescence resonance energy transfer (FRET) and those based on bioluminescence energy transfer (BRET)DepositorInsertEpac-sensor (RAPGEF3 Synthetic, Human)
TagsYPet and Turquoise2GLExpressionMammalianPromoterCAGAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKMW123_SpRY-Cas9_U6-entry
Plasmid#244820PurposeMammalian expression of SpRY Cas9 with Golden Gate-compatible sgRNA spacer cassetteDepositorInsertSpRY Cas9
UseCRISPRTags3xFLAG-SV40 NLS and Nucleoplasmin NLSExpressionMammalianMutationA61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1…PromoterCAG, U6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PC-GCaMP6f
Plasmid#73503PurposeGCaMP6f knock in construct into the AAVS1 locusDepositorInsertGCaMP6f
ExpressionMammalianPromoterCAGAvailable SinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
WT Smarca4-sfGFP
Plasmid#107056PurposeExpression of wild-type Smarca4 (Brg1) with C-terminal super-folder GFP fusion.DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4 Mouse)
UseLentiviralTagsSuper-folder GFP (sfGFP)ExpressionMammalianMutationwild-typePromoterCAGAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
WT Smarca4-V5 IRES-puro
Plasmid#107058PurposeExpression of wild-type Smarca4 (Brg1)-V5 fusion with IRES puromycin resistance.DepositorInsertSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4 (Smarca4 Mouse)
UseLentiviralTagsIRES-puroR and V5ExpressionMammalianMutationwild-typePromoterCAGAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only