We narrowed to 92,625 results for: MAL
-
Plasmid#136445PurposeMammalian expression plasmid for HCMV glycoprotein H (TB40/E strain) extracellular domain with 8his purification tagDepositorInsertglycoprotein H (UL75 Human betaherpesvirus 5)
TagsShort GGSG linker and 8his tagExpressionMammalianMutationExtracellular domain (a.a. 1-717). Codon-optimize…PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-8his (TB40/E)
Plasmid#136453PurposeMammalian expression plasmid for HCMV glycoprotein O (TB40/E strain) with an 8his tagDepositorInsertenvelope glycoprotein O (UL74 Human betaherpesvirus 5)
TagsLinker and 8his tag (GGSGHHHHHHHH, includes BamHI…ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-Ef1a-mCh
Plasmid#31847PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both mCherry and shRNA to be recombined out of the construct, turning OFF shRNA expression.DepositorTypeEmpty backboneUseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6 for shRNA; Ef1alpha for mCherryAvailable SinceJan. 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
NKP38 GFP (1009)
Plasmid#62021Purposemammalian expression of nuclear envelope transmembrane proteinDepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSH231-EF1-BLST-dCas9-VPR
Plasmid#115148PurposeSafe harbor site 231 knock-in vector with BlastR-dCas9-VPR expression cassetteDepositorInsertBlastR-P2A-dCas9-VPR
UseCRISPRTagsNucleoplasmin NLS and SV40NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-Ce67
Plasmid#124680PurposeTuning expression of PD-1DepositorAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
peGFP C3-SPG20-PAAA
Plasmid#218581PurposeExpresses GFP-tagged PPAY motif mutant (PAAA) of human SPG20 in mammalian cells; this mutant does not interact with ITCHDepositorInsertSPG20 (SPART Human)
TagseGFPExpressionMammalianMutationchanged Proline 172 to Alanine and Tyrosine 174 t…PromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTipi2.1_Anti-GCN4 [IPI-C11L34] Mouse/Rabbit HC
Plasmid#221353PurposeMammalian expression of Anti-GCN4 [IPI-C11L34] Mouse/Rabbit HC; to be used with Anti-GCN4 [IPI-C11L34] light chain (Plasmid 221354) to make the antibody.DepositorInsertAnti-GCN4 [IPI-C11L34] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
LUC01 (L/Sec/P)
Plasmid#112144PurposeMammalian expression vector to test the effect of substituting selenocysteine for Cys on luciferase enzyme activityDepositorInsertLuciferase coding region with Cysteine 258 mutated to selenocysteine (U) and wild-type PHGPx SECIS in the 3' UTR (Gpx4 Rat, Photinus pyralis)
ExpressionMammalianMutationCysteine 258 mutated to selenocysteine (U)Available SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLEX-Frb:Akt2-IRES-Hygromycin
Plasmid#120713PurposeExpresses Frb:Akt2 fusion protein in mammalian cells & for virus productionDepositorAvailable SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSYN-DRD2-V2tail-TevN-BLITz1-TetR-VP16-bGHpA
Plasmid#89874Purposeexpresses DRD2-iTango component in mammalian cells for AAV productionDepositorInsertDRD2-V2tail-TevN-BLITz1-TetR-VP16
UseAAVTagsFLAGExpressionMammalianMutationshort isoform of DRD2 (deletion of 242-270)PromoterHuman synapsinAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
TPC2-D276K-G-GECO1.2
Plasmid#207142PurposeFusion of Ca2+ reporter and pore-dead lysosomal Ca2+-permeable channelDepositorInsertTPC2N2 (TPCN2 Human)
TagsG-GECO1.2ExpressionMammalianMutationChanged Aspartate 276 to LysinePromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
Plasmid#173871PurposeMammalian expression of mCherry-NES-SspB-Tiam-DHPH-P2A-iLIDcaax (opto-Rac1)DepositorInsertmCherry-NES-SspB-Tiam-DHPH-P2A-iLIDcaax
TagsC-terminal CAAX-box and mCherryExpressionMammalianPromoterCMVAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2J1
Plasmid#124669PurposeExpresses UBE2J1 with N-terminal Strep-HA tag in mammalian cellsDepositorAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
PD-1-miSFIT-6-C, 16-C
Plasmid#124681PurposeTuning expression of PD-1DepositorAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTipi2.1_Anti-ProC [IPI-HPC-4] Mouse/Rabbit HC
Plasmid#221361PurposeMammalian expression of Anti-ProC [IPI-HPC-4] Mouse/Rabbit HC; to be used with Anti-ProC [IPI-HPC-4] light chain (Plasmid 221362) to make the antibody.DepositorInsertAnti-ProC [IPI-HPC-4] Mouse/Rabbit HC
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDNA_B2AR-s-pep
Plasmid#47438PurposeFRET sensor for beta2-adrenergic receptorDepositorInsertbeta2-adrenergic receptor (ADRB2 Human)
Tags10 nm ER/K helix, HA, mCerulean, mCitrine, and s-…ExpressionMammalianPromoterpCMVAvailable SinceSept. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
LUC05 (L/Cys/P)
Plasmid#112146PurposeMammalian expression vector to test the effect of substituting selenocysteine for Cys on luciferase enzyme activityDepositorInsertLuciferase coding region with wild type Cysteine 258 and wild-type PHGPx SECIS in the 3' UTR (Gpx4 Rat, Photinus pyralis)
ExpressionMammalianMutationnoneAvailable SinceJuly 6, 2018AvailabilityAcademic Institutions and Nonprofits only