We narrowed to 17,671 results for: ENA
-
Plasmid#103378PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-26a-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-26a-2-3p target (MIR26A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-31-3p
Plasmid#103420PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-31-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-96-5p
Plasmid#103761PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-96-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-126-5p
Plasmid#103193PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-126-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-126-5p target (MIR126 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-200c-3p
Plasmid#103332PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-200c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-200c-3p target (MIR200C Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-2-3p
Plasmid#103155PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-2-3p target (MIRLET7F2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXs_FLAG-MCART1W283A
Plasmid#138409PurposeExpress FLAG-tagged MCART1W283A in mammalian cellsDepositorInsertSLC25A51 (SLC25A51 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationcodon-optimized for expression in human cells, W2…Available SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-93-3p
Plasmid#103755PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-93-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-130b-5p
Plasmid#103218PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-130b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-130b-5p target (MIR130B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-PGK-Puro
Plasmid#110857PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pECE M2-SH3PXD2A 8 serines mutated to alanines
Plasmid#69816PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-152-3p
Plasmid#103260PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-152-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-152-3p target (MIR152 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-145-5p
Plasmid#103246PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-145-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-145-5p target (MIR145 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO NET1A-V5 WT
Plasmid#69828PurposeExpresses NET1A-V5 in mammalian cells in a doxycycline inducible mannerDepositorInsertNeuroepithelial cell-transforming gene 1 protein A (NET1 Human)
UseLentiviralTagsv5ExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQRRA-PGK-Puro
Plasmid#110858PurposeLentiviral vector for constitutive expression of Cas9-VQRRA in mammalian cells (codon optimized)DepositorInsertCas9-VQRRA
UseLentiviralTagsFLAGMutationD1135V, R1335Q, T1337R and NLS sequence at the N-…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
B52 + TIMELESS sgSTOP
Plasmid#100713PurposeB52 plasmid expressing TIMELESS sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting TIMELESS (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-551b-3p
Plasmid#103642PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-551b-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-551b-3p target (MIR551B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF3-Q147H-FLAG-IRES-GFP
Plasmid#69050Purposelentiviral expression of IKZF3 with Q147H mutation and FLAG tagDepositorInsertIKZF3 (IKZF3 Human)
UseLentiviralTagsFLAG and IRES-GFPExpressionMammalianMutationQ147HPromoterCAGAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only